Transcript: Human NM_001198837.2

Homo sapiens RNA binding motif protein 14 (RBM14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
RBM14 (10432)
Length:
3902
CDS:
92..451

Additional Resources:

NCBI RefSeq record:
NM_001198837.2
NBCI Gene record:
RBM14 (10432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338127 CGCTATTCGGGCTCCTATAAT pLKO_005 565 3UTR 100% 15.000 21.000 N Rbm14 n/a
2 TRCN0000338126 TATGGTTCCGACCGGCGTTTA pLKO_005 430 CDS 100% 10.800 15.120 N Rbm14 n/a
3 TRCN0000168763 GAACTTGCCTGTGACAGAATA pLKO.1 2380 3UTR 100% 13.200 9.240 N RBM14 n/a
4 TRCN0000168667 GCCACCTGTGTTAATCCTATA pLKO.1 3080 3UTR 100% 10.800 7.560 N RBM14 n/a
5 TRCN0000172390 CACTGGCTTCATGTGAACTTG pLKO.1 2366 3UTR 100% 4.950 3.465 N RBM14 n/a
6 TRCN0000167142 CCAAGTTAATAAGCCTACCTT pLKO.1 2666 3UTR 100% 3.000 2.100 N RBM14 n/a
7 TRCN0000168602 GTGACAGAATATCTTGCCCTA pLKO.1 2390 3UTR 100% 2.160 1.512 N RBM14 n/a
8 TRCN0000072693 CCCAGGAGATGATCCTGTTAA pLKO.1 772 3UTR 100% 1.320 0.924 N RBM14 n/a
9 TRCN0000166856 CTTTAAAGACTCGATTTGGGA pLKO.1 2268 3UTR 100% 0.750 0.525 N RBM14 n/a
10 TRCN0000072694 GCCTCTTAATACTTGGAAGAT pLKO.1 313 CDS 100% 4.950 2.475 Y RBM14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02429 pDONR223 100% 17.1% 16.7% None (many diffs) n/a
2 TRCN0000470874 TTACCTGGGGAATACAAAACAACC pLX_317 18.5% 17.1% 16.7% V5 (many diffs) n/a
Download CSV