Transcript: Human NM_001198846.1

Homo sapiens RBM14-RBM4 readthrough (RBM14-RBM4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-03-19
Taxon:
Homo sapiens (human)
Gene:
RBM14-RBM4 (100526737)
Length:
923
CDS:
140..496

Additional Resources:

NCBI RefSeq record:
NM_001198846.1
NBCI Gene record:
RBM14-RBM4 (100526737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160719 CCTGTTCTTCTGTCCTTCAAT pLKO.1 663 3UTR 100% 5.625 2.813 Y RBM4 n/a
2 TRCN0000338541 CCTGTTCTTCTGTCCTTCAAT pLKO_005 663 3UTR 100% 5.625 2.813 Y RBM4 n/a
3 TRCN0000159632 GACCTTAATTTACCTTGCTAA pLKO.1 594 3UTR 100% 4.950 2.475 Y RBM4 n/a
4 TRCN0000072694 GCCTCTTAATACTTGGAAGAT pLKO.1 361 CDS 100% 4.950 2.475 Y RBM14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02429 pDONR223 100% 17.1% 16.8% None (many diffs) n/a
2 TRCN0000470874 TTACCTGGGGAATACAAAACAACC pLX_317 18.5% 17.1% 16.8% V5 (many diffs) n/a
Download CSV