Transcript: Human NM_001198868.2

Homo sapiens calpain 1 (CAPN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CAPN1 (823)
Length:
2904
CDS:
40..2184

Additional Resources:

NCBI RefSeq record:
NM_001198868.2
NBCI Gene record:
CAPN1 (823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003560 CTAGAGACCATGTTCCGATTT pLKO.1 2083 CDS 100% 10.800 15.120 N CAPN1 n/a
2 TRCN0000003559 CGACATGGAGACTATTGGCTT pLKO.1 1347 CDS 100% 2.640 2.112 N CAPN1 n/a
3 TRCN0000432907 GCCTTGCCTGCAGACTATAAA pLKO_005 2545 3UTR 100% 15.000 10.500 N CAPN1 n/a
4 TRCN0000422363 CATTTCCAGCTGTGGCAATTT pLKO_005 487 CDS 100% 13.200 9.240 N CAPN1 n/a
5 TRCN0000003561 AGGGACTTGTGTACTGGTTAT pLKO.1 2791 3UTR 100% 10.800 7.560 N CAPN1 n/a
6 TRCN0000431534 GTGAAGGAGTTGCGGACAATC pLKO_005 1726 CDS 100% 10.800 7.560 N CAPN1 n/a
7 TRCN0000003558 AGAGGAGATTGACGAGAACTT pLKO.1 1659 CDS 100% 4.950 3.465 N CAPN1 n/a
8 TRCN0000003562 CCCAATTCCTCCAAGACCTAT pLKO.1 262 CDS 100% 4.950 3.465 N CAPN1 n/a
9 TRCN0000417952 AGGCCTATGCCAAGGTAAATG pLKO_005 617 CDS 100% 13.200 7.920 N CAPN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00214 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00214 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479881 GCCACTTTGTAGGCGCCATTCGAC pLX_317 19.1% 100% 100% V5 n/a
4 ccsbBroadEn_15373 pDONR223 0% 99.9% 99.8% None 1644G>T n/a
5 ccsbBroad304_15373 pLX_304 0% 99.9% 99.8% V5 1644G>T n/a
Download CSV