Transcript: Human NM_001198916.2

Homo sapiens PPFIA binding protein 1 (PPFIBP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PPFIBP1 (8496)
Length:
5908
CDS:
284..3226

Additional Resources:

NCBI RefSeq record:
NM_001198916.2
NBCI Gene record:
PPFIBP1 (8496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338307 CATTGGCCTCCCTCAATATAA pLKO_005 2380 CDS 100% 15.000 21.000 N PPFIBP1 n/a
2 TRCN0000002959 CCTCAATATAAGACCCAGTTT pLKO.1 2390 CDS 100% 4.950 6.930 N PPFIBP1 n/a
3 TRCN0000002958 CCAGAGTGTTTCCATTCATAT pLKO.1 3507 3UTR 100% 13.200 9.240 N PPFIBP1 n/a
4 TRCN0000338306 CCAGAGTGTTTCCATTCATAT pLKO_005 3507 3UTR 100% 13.200 9.240 N PPFIBP1 n/a
5 TRCN0000338369 TACTACCATCTTGCAAGTTTC pLKO_005 1393 CDS 100% 10.800 7.560 N PPFIBP1 n/a
6 TRCN0000002961 GCCAAAGTGAAGCCAAAGAAA pLKO.1 2882 CDS 100% 5.625 3.938 N PPFIBP1 n/a
7 TRCN0000338367 GCCAAAGTGAAGCCAAAGAAA pLKO_005 2882 CDS 100% 5.625 3.938 N PPFIBP1 n/a
8 TRCN0000002957 CGGTTAGAGCAGATGGAAGAT pLKO.1 3062 CDS 100% 4.950 3.465 N PPFIBP1 n/a
9 TRCN0000002960 GCGTGGATTGTTAGAGATGAT pLKO.1 448 CDS 100% 4.950 3.465 N PPFIBP1 n/a
10 TRCN0000338366 GCGTGGATTGTTAGAGATGAT pLKO_005 448 CDS 100% 4.950 3.465 N PPFIBP1 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 4274 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5721 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 4241 3UTR 100% 4.950 2.475 Y RBM48 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5721 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07246 pDONR223 100% 96.8% 96.8% None 252A>G;442G>T;696_697ins93 n/a
2 ccsbBroad304_07246 pLX_304 0% 96.8% 96.8% V5 252A>G;442G>T;696_697ins93 n/a
3 TRCN0000480925 TGCATACCACCTTCAATACTCTAT pLX_317 13.7% 96.8% 96.8% V5 252A>G;442G>T;696_697ins93 n/a
Download CSV