Transcript: Human NM_001198962.1

Homo sapiens enoyl-CoA hydratase domain containing 2 (ECHDC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
ECHDC2 (55268)
Length:
1447
CDS:
102..836

Additional Resources:

NCBI RefSeq record:
NM_001198962.1
NBCI Gene record:
ECHDC2 (55268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036974 GCCTGATGAATGACATCGCTT pLKO.1 448 CDS 100% 2.640 3.696 N ECHDC2 n/a
2 TRCN0000446499 TTGCATCTGGGATGGCCATTG pLKO_005 718 CDS 100% 6.000 4.200 N ECHDC2 n/a
3 TRCN0000439847 GAGCGGGAACAGATGAGTGAA pLKO_005 393 CDS 100% 4.950 3.465 N ECHDC2 n/a
4 TRCN0000036977 GATCACTGAGATTCTGATGAA pLKO.1 224 CDS 100% 4.950 3.465 N ECHDC2 n/a
5 TRCN0000036976 GCTCTTCAGAAGTGGAGTGAA pLKO.1 341 CDS 100% 4.950 3.465 N ECHDC2 n/a
6 TRCN0000447254 GGGAATGTCTTCGTCAGTGAG pLKO_005 270 CDS 100% 4.050 2.835 N ECHDC2 n/a
7 TRCN0000036978 GACTCCCAAATTTGTTGGCAA pLKO.1 812 CDS 100% 2.640 1.848 N ECHDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08500 pDONR223 100% 83.4% 83.2% None 355A>G;363_364ins93;607_608ins51 n/a
2 ccsbBroad304_08500 pLX_304 0% 83.4% 83.2% V5 355A>G;363_364ins93;607_608ins51 n/a
3 TRCN0000468030 CATCTCCCAAGAGGATTAGTACTA pLX_317 49.3% 83.4% 83.2% V5 355A>G;363_364ins93;607_608ins51 n/a
Download CSV