Transcript: Mouse NM_001199016.1

Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 (Slc7a9), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc7a9 (30962)
Length:
1702
CDS:
100..1563

Additional Resources:

NCBI RefSeq record:
NM_001199016.1
NBCI Gene record:
Slc7a9 (30962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313370 GTTGGAACCAACTCAACTATA pLKO_005 800 CDS 100% 13.200 18.480 N Slc7a9 n/a
2 TRCN0000079442 GCTTGGCACAATGATTACCAA pLKO.1 354 CDS 100% 3.000 4.200 N Slc7a9 n/a
3 TRCN0000312342 GCTTGGCACAATGATTACCAA pLKO_005 354 CDS 100% 3.000 4.200 N Slc7a9 n/a
4 TRCN0000079440 CCTATCATTGTGATTCTCGTA pLKO.1 1339 CDS 100% 2.640 3.696 N Slc7a9 n/a
5 TRCN0000079438 GCTCTCCTACATCAGTGTCAA pLKO.1 1119 CDS 100% 4.950 3.960 N Slc7a9 n/a
6 TRCN0000312343 GCTCTCCTACATCAGTGTCAA pLKO_005 1119 CDS 100% 4.950 3.960 N Slc7a9 n/a
7 TRCN0000313372 ATCAACTCCTTAGTCAATTAT pLKO_005 1210 CDS 100% 15.000 10.500 N Slc7a9 n/a
8 TRCN0000313306 TCATACTGAGTGGACTTATAT pLKO_005 1427 CDS 100% 15.000 10.500 N Slc7a9 n/a
9 TRCN0000079441 GTATGCTACATCCTCATGAAT pLKO.1 892 CDS 100% 5.625 3.938 N Slc7a9 n/a
10 TRCN0000079439 CCAAGGAAATGTAAAGAACTT pLKO.1 699 CDS 100% 4.950 3.465 N Slc7a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02625 pDONR223 100% 83.5% 86.8% None (many diffs) n/a
2 ccsbBroad304_02625 pLX_304 0% 83.5% 86.8% V5 (many diffs) n/a
3 TRCN0000480861 AGTCCTACGGTTGTGAATCTGCTC pLX_317 33.2% 83.5% 86.8% V5 (many diffs) n/a
Download CSV