Transcript: Human NM_001199121.2

Homo sapiens ribonuclease P/MRP subunit p21 (RPP21), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
RPP21 (79897)
Length:
572
CDS:
17..451

Additional Resources:

NCBI RefSeq record:
NM_001199121.2
NBCI Gene record:
RPP21 (79897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049719 ACCACTACAACCCTTGCCAAA pLKO.1 398 CDS 100% 4.050 2.025 Y RPP21 n/a
2 TRCN0000290742 ACCACTACAACCCTTGCCAAA pLKO_005 398 CDS 100% 4.050 2.025 Y RPP21 n/a
3 TRCN0000049721 CACTGAGAGGACCATTGCGAA pLKO.1 136 CDS 100% 2.640 1.320 Y RPP21 n/a
4 TRCN0000290744 CACTGAGAGGACCATTGCGAA pLKO_005 136 CDS 100% 2.640 1.320 Y RPP21 n/a
5 TRCN0000049722 CGCAGCCAACGCTTCCTCAAT pLKO.1 305 CDS 100% 1.650 0.825 Y RPP21 n/a
6 TRCN0000290745 CGCAGCCAACGCTTCCTCAAT pLKO_005 305 CDS 100% 1.650 0.825 Y RPP21 n/a
7 TRCN0000049720 TGGACCGTACAGACCTGCCTA pLKO.1 275 CDS 100% 0.880 0.440 Y RPP21 n/a
8 TRCN0000290674 TGGACCGTACAGACCTGCCTA pLKO_005 275 CDS 100% 0.880 0.440 Y RPP21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08979 pDONR223 100% 90.4% 75.1% None 231G>C;366_372delAGGTGAG;432_433ins37 n/a
2 ccsbBroad304_08979 pLX_304 0% 90.4% 75.1% V5 231G>C;366_372delAGGTGAG;432_433ins37 n/a
3 TRCN0000473156 CTTAAGAACCCACATGAATTAGTT pLX_317 98.7% 90.4% 75.1% V5 231G>C;366_372delAGGTGAG;432_433ins37 n/a
Download CSV