Transcript: Human NM_001199142.1

Homo sapiens eukaryotic translation initiation factor 3 subunit C (EIF3C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
EIF3C (8663)
Length:
3265
CDS:
302..3043

Additional Resources:

NCBI RefSeq record:
NM_001199142.1
NBCI Gene record:
EIF3C (8663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147778 GACCTAGAGGACTATCTTAAT pLKO.1 635 CDS 100% 13.200 6.600 Y EIF3C n/a
2 TRCN0000149343 GCTGGCCTCAAGATTTCTTAA pLKO.1 1054 CDS 100% 13.200 6.600 Y EIF3C n/a
3 TRCN0000256117 TGACCTAGAGGACTATCTTAA pLKO_005 634 CDS 100% 13.200 6.600 Y EIF3CL n/a
4 TRCN0000256121 ATCCAACCTTGAAGTCCTAAA pLKO_005 3072 3UTR 100% 10.800 5.400 Y EIF3CL n/a
5 TRCN0000256119 CTTATCCGGACCATCCGTAAT pLKO_005 488 CDS 100% 10.800 5.400 Y EIF3CL n/a
6 TRCN0000256120 GCCACTTGCAGGACAACATTC pLKO_005 2076 CDS 100% 10.800 5.400 Y EIF3CL n/a
7 TRCN0000256118 GGAGTCAGTGCTGCAACTTTC pLKO_005 869 CDS 100% 10.800 5.400 Y EIF3CL n/a
8 TRCN0000150015 CACACCTACTACAAGTTTGAT pLKO.1 1826 CDS 100% 5.625 2.813 Y EIF3C n/a
9 TRCN0000146407 CATCCAACCTTGAAGTCCTAA pLKO.1 3071 3UTR 100% 4.950 2.475 Y EIF3C n/a
10 TRCN0000148740 CCTGTTTGCAAATCCCAACAT pLKO.1 1534 CDS 100% 4.950 2.475 Y EIF3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01982 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01982 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478431 GTAAGTACACCCCTAATCTCTATT pLX_317 11.5% 100% 100% V5 n/a
Download CSV