Transcript: Mouse NM_001199177.1

Mus musculus OPA1, mitochondrial dynamin like GTPase (Opa1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Opa1 (74143)
Length:
6002
CDS:
207..3143

Additional Resources:

NCBI RefSeq record:
NM_001199177.1
NBCI Gene record:
Opa1 (74143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091109 CCCGACACAAAGGAAACTATT pLKO.1 1494 CDS 100% 13.200 18.480 N Opa1 n/a
2 TRCN0000379307 GTAGATGCTGAGCGCAGTATT pLKO_005 1581 CDS 100% 13.200 18.480 N Opa1 n/a
3 TRCN0000091110 GCCTGACTTTATATGGGAAAT pLKO.1 614 CDS 100% 10.800 8.640 N Opa1 n/a
4 TRCN0000363838 GCCTGACTTTATATGGGAAAT pLKO_005 614 CDS 100% 10.800 8.640 N Opa1 n/a
5 TRCN0000348537 ACGGTGAGAAGAAGGTTAAAT pLKO_005 3019 CDS 100% 15.000 10.500 N Opa1 n/a
6 TRCN0000375527 CATGGAAGAAGAACCATATTT pLKO_005 1632 CDS 100% 15.000 10.500 N Opa1 n/a
7 TRCN0000091111 CCGACACAAAGGAAACTATTT pLKO.1 1495 CDS 100% 13.200 9.240 N Opa1 n/a
8 TRCN0000363834 CCGACACAAAGGAAACTATTT pLKO_005 1495 CDS 100% 13.200 9.240 N Opa1 n/a
9 TRCN0000091108 CCTCTGCGTTTATTTGAAGAA pLKO.1 3176 3UTR 100% 4.950 3.465 N Opa1 n/a
10 TRCN0000335322 CCTCTGCGTTTATTTGAAGAA pLKO_005 3176 3UTR 100% 4.950 3.465 N Opa1 n/a
11 TRCN0000091112 GCCAGTTACAATACACAAGAT pLKO.1 1098 CDS 100% 4.950 2.970 N Opa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06671 pDONR223 100% 87% 94.4% None (many diffs) n/a
2 ccsbBroad304_06671 pLX_304 0% 87% 94.4% V5 (many diffs) n/a
Download CSV