Transcript: Human NM_001199506.1

Homo sapiens phosphatase and actin regulator 3 (PHACTR3), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
PHACTR3 (116154)
Length:
2270
CDS:
110..1666

Additional Resources:

NCBI RefSeq record:
NM_001199506.1
NBCI Gene record:
PHACTR3 (116154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052689 GCGCTGAACGACTCCATTATT pLKO.1 1136 CDS 100% 15.000 21.000 N PHACTR3 n/a
2 TRCN0000417397 TGGAACACTGCCACGGAAATG pLKO_005 1159 CDS 100% 10.800 15.120 N PHACTR3 n/a
3 TRCN0000425136 GACCCACTGTTGATGAATTAA pLKO_005 1443 CDS 100% 15.000 12.000 N PHACTR3 n/a
4 TRCN0000430649 CTGATACGATTCAGTGATTAC pLKO_005 1478 CDS 100% 10.800 8.640 N PHACTR3 n/a
5 TRCN0000431962 TGATACCAACACTGAACATTC pLKO_005 1703 3UTR 100% 10.800 7.560 N PHACTR3 n/a
6 TRCN0000431986 TGCAATCTTGACCACACTTAC pLKO_005 1804 3UTR 100% 10.800 7.560 N PHACTR3 n/a
7 TRCN0000052690 CCAAGCAAACAGGAACTAGAA pLKO.1 1217 CDS 100% 4.950 3.465 N PHACTR3 n/a
8 TRCN0000052692 CGCTAAGGAATCTGAGGAGAA pLKO.1 1051 CDS 100% 4.050 2.835 N PHACTR3 n/a
9 TRCN0000052691 GCAGCAGATAAGGCAGCAATT pLKO.1 1562 CDS 100% 10.800 6.480 N PHACTR3 n/a
10 TRCN0000052688 GCTGTGTTTGTGAGAAGAGTA pLKO.1 1767 3UTR 100% 4.950 2.970 N PHACTR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04697 pDONR223 100% 92.6% 92.6% None 0_1ins123 n/a
2 ccsbBroad304_04697 pLX_304 0% 92.6% 92.6% V5 0_1ins123 n/a
3 TRCN0000470159 CACGTGACTTTCCAAGATCCGTTG pLX_317 20.6% 92.6% 92.6% V5 0_1ins123 n/a
Download CSV