Transcript: Human NM_001199834.1

Homo sapiens vascular cell adhesion molecule 1 (VCAM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
VCAM1 (7412)
Length:
3034
CDS:
222..2255

Additional Resources:

NCBI RefSeq record:
NM_001199834.1
NBCI Gene record:
VCAM1 (7412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414856 GAATGCAACTCTCACCTTAAT pLKO_005 1715 CDS 100% 13.200 18.480 N VCAM1 n/a
2 TRCN0000412974 GGAATTAATTATCCAAGTTAC pLKO_005 1811 CDS 100% 10.800 8.640 N VCAM1 n/a
3 TRCN0000123171 CGAGCTAAATTACACATTGAT pLKO.1 621 CDS 100% 5.625 3.938 N VCAM1 n/a
4 TRCN0000123170 CGGGAGTATATGAATGTGAAT pLKO.1 2023 CDS 100% 4.950 3.465 N VCAM1 n/a
5 TRCN0000123173 CTGGAGATAGACTTACTGAAA pLKO.1 477 CDS 100% 4.950 3.465 N VCAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01763 pDONR223 100% 91.5% 91.6% None 152_153ins186;2022G>A n/a
2 ccsbBroad304_01763 pLX_304 0% 91.5% 91.6% V5 152_153ins186;2022G>A n/a
3 TRCN0000473670 CCAGACTCTCATTCTTATGATCGA pLX_317 16.1% 91.5% 91.6% V5 152_153ins186;2022G>A n/a
Download CSV