Transcript: Human NM_001201380.2

Homo sapiens contactin associated protein like 3B (CNTNAP3B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CNTNAP3B (728577)
Length:
6379
CDS:
411..4277

Additional Resources:

NCBI RefSeq record:
NM_001201380.2
NBCI Gene record:
CNTNAP3B (728577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426667 AGTGTACGGATGTGCATATAA pLKO_005 929 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
2 TRCN0000418828 CAATGAGATTTCCGCATATTT pLKO_005 3401 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
3 TRCN0000432823 GCAGTTTGATCTGTGTTAATA pLKO_005 4589 3UTR 100% 15.000 7.500 Y CNTNAP3 n/a
4 TRCN0000430293 ACACGAACTCCGAGCTTATTG pLKO_005 3555 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
5 TRCN0000431523 CACAGTCCTCCACATCAATTT pLKO_005 4494 3UTR 100% 13.200 6.600 Y CNTNAP3 n/a
6 TRCN0000119185 CGCCGTCAAATCTCTCATATT pLKO.1 3818 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
7 TRCN0000119182 GCCTGGAAACACTACCATTAT pLKO.1 4908 3UTR 100% 13.200 6.600 Y CNTNAP3 n/a
8 TRCN0000424272 GGAGTGGATGTTACCGAATTA pLKO_005 1428 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
9 TRCN0000119184 CAGATCCTCATGATGGGAAAT pLKO.1 1467 CDS 100% 10.800 5.400 Y CNTNAP3 n/a
10 TRCN0000415592 CCATAGCCATACGCATCTATC pLKO_005 4198 CDS 100% 10.800 5.400 Y CNTNAP3 n/a
11 TRCN0000119186 ACAGAGCAGGACATTTGCTTT pLKO.1 1615 CDS 100% 4.950 2.475 Y CNTNAP3 n/a
12 TRCN0000119183 CCTCTTTCTTAAGGATGGCAA pLKO.1 1670 CDS 100% 2.640 1.320 Y CNTNAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12646 pDONR223 100% 92.4% 92% None (many diffs) n/a
2 ccsbBroad304_12646 pLX_304 0% 92.4% 92% V5 (many diffs) n/a
3 TRCN0000476859 AGTTTCTCGCGGTACGTTTCCTTC pLX_317 12.5% 92.4% 92% V5 (many diffs) n/a
Download CSV