Transcript: Human NM_001201427.2

Homo sapiens dishevelled associated activator of morphogenesis 2 (DAAM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
DAAM2 (23500)
Length:
6185
CDS:
147..3353

Additional Resources:

NCBI RefSeq record:
NM_001201427.2
NBCI Gene record:
DAAM2 (23500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152691 GCTTGACCTGTCTGCTAAATT pLKO.1 604 CDS 100% 15.000 21.000 N DAAM2 n/a
2 TRCN0000280901 GCTTGACCTGTCTGCTAAATT pLKO_005 604 CDS 100% 15.000 21.000 N DAAM2 n/a
3 TRCN0000156462 CGGGCAATAAACCGGCTAAAT pLKO.1 3327 CDS 100% 13.200 18.480 N DAAM2 n/a
4 TRCN0000280898 CGGGCAATAAACCGGCTAAAT pLKO_005 3327 CDS 100% 13.200 18.480 N DAAM2 n/a
5 TRCN0000153125 GCTGGTCCTTAATAGGTTGTT pLKO.1 5731 3UTR 100% 4.950 6.930 N DAAM2 n/a
6 TRCN0000156640 GCTAAATTTCCTCCGGAGCAT pLKO.1 617 CDS 100% 2.640 3.696 N DAAM2 n/a
7 TRCN0000153406 GCCATCCTGGACAAACATTTA pLKO.1 1110 CDS 100% 13.200 9.240 N DAAM2 n/a
8 TRCN0000280900 GCCATCCTGGACAAACATTTA pLKO_005 1110 CDS 100% 13.200 9.240 N DAAM2 n/a
9 TRCN0000158307 CAGAGTCTGTACGCGTTTGAT pLKO.1 483 CDS 100% 5.625 3.938 N DAAM2 n/a
10 TRCN0000297916 CAGAGTCTGTACGCGTTTGAT pLKO_005 483 CDS 100% 5.625 3.938 N DAAM2 n/a
11 TRCN0000158251 CCTGAGGCCATTAGTACCATA pLKO.1 738 CDS 100% 4.950 3.465 N DAAM2 n/a
12 TRCN0000158225 CCTGATCATGATCCTGGAGAA pLKO.1 2678 CDS 100% 4.050 2.835 N DAAM2 n/a
13 TRCN0000280899 CCTGATCATGATCCTGGAGAA pLKO_005 2678 CDS 100% 4.050 2.835 N DAAM2 n/a
14 TRCN0000151161 GCTCTTATTCAATACCACGTT pLKO.1 4824 3UTR 100% 2.640 1.848 N DAAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11740 pDONR223 100% 11.1% 9.1% None (many diffs) n/a
2 ccsbBroad304_11740 pLX_304 0% 11.1% 9.1% V5 (many diffs) n/a
3 TRCN0000472513 TCGCCATTCCCTTTTGTTCAATTA pLX_317 61% 11.1% 9.1% V5 (many diffs) n/a
Download CSV