Transcript: Human NM_001201965.2

Homo sapiens ankyrin repeat and SOCS box containing 3 (ASB3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ASB3 (51130)
Length:
2553
CDS:
693..2030

Additional Resources:

NCBI RefSeq record:
NM_001201965.2
NBCI Gene record:
ASB3 (51130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165912 GCAGCTTCATCACCAGTACAT pLKO.1 2269 3UTR 100% 4.950 3.465 N ASB3 n/a
2 TRCN0000160443 CCTAATGCAACTACTTTAGAA pLKO.1 786 CDS 100% 5.625 2.813 Y ASB3 n/a
3 TRCN0000166388 CCCTGTTTACTCAGCAGTGTT pLKO.1 1319 CDS 100% 4.950 2.475 Y ASB3 n/a
4 TRCN0000159947 GAAACTACTTAACACAGCTAA pLKO.1 2037 3UTR 100% 4.950 2.475 Y ASB3 n/a
5 TRCN0000165009 GCTGGATTTGACCCACTGATT pLKO.1 1674 CDS 100% 4.950 2.475 Y ASB3 n/a
6 TRCN0000159225 CTAGAAATATTACTCCGGAAT pLKO.1 1359 CDS 100% 4.050 2.025 Y ASB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201965.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03223 pDONR223 100% 85.9% 85.9% None 0_1ins219 n/a
2 ccsbBroad304_03223 pLX_304 0% 85.9% 85.9% V5 0_1ins219 n/a
3 TRCN0000474116 CGATTCGGATACCGTCAAGCACCT pLX_317 29.9% 85.9% 85.9% V5 0_1ins219 n/a
Download CSV