Transcript: Human NM_001202413.1

Homo sapiens aldo-keto reductase family 1 member A1 (AKR1A1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
AKR1A1 (10327)
Length:
1380
CDS:
291..1268

Additional Resources:

NCBI RefSeq record:
NM_001202413.1
NBCI Gene record:
AKR1A1 (10327)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231970 ACTTCAACAGTCGGCAGATTG pLKO_005 778 CDS 100% 10.800 15.120 N AKR1A1 n/a
2 TRCN0000046421 CCTTCAGAACATCAAGGTGTT pLKO.1 1100 CDS 100% 4.050 5.670 N AKR1A1 n/a
3 TRCN0000046420 GCAGCTGTTAAGTATGCCCTT pLKO.1 381 CDS 100% 2.160 3.024 N AKR1A1 n/a
4 TRCN0000288810 GCAGCTGTTAAGTATGCCCTT pLKO_005 381 CDS 100% 2.160 3.024 N AKR1A1 n/a
5 TRCN0000046418 GCAGCTAAATGCCCTGAACAA pLKO.1 1151 CDS 100% 4.950 3.960 N AKR1A1 n/a
6 TRCN0000231969 GAATGCTGATGGGACTATATG pLKO_005 671 CDS 100% 13.200 9.240 N AKR1A1 n/a
7 TRCN0000231971 GCCTGGAGGTAACTGCTTATA pLKO_005 901 CDS 100% 13.200 9.240 N AKR1A1 n/a
8 TRCN0000231968 ACGGCAATGAGCCTGAGATTG pLKO_005 439 CDS 100% 10.800 7.560 N AKR1A1 n/a
9 TRCN0000231967 AGGCTACCGCCACATTGATTG pLKO_005 407 CDS 100% 10.800 7.560 N AKR1A1 n/a
10 TRCN0000046419 GCCACATTGATTGTGCTGCTA pLKO.1 415 CDS 100% 2.640 1.848 N AKR1A1 n/a
11 TRCN0000046422 GCAGGTGGAATGCCACCCATA pLKO.1 839 CDS 100% 0.135 0.095 N AKR1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02401 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02401 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472565 CCCTTCACCGTTGTTACACGGTTT pLX_317 43% 100% 100% V5 n/a
4 ccsbBroadEn_07587 pDONR223 100% 99.8% 100% None 558A>G n/a
5 ccsbBroad304_07587 pLX_304 0% 99.8% 100% V5 558A>G n/a
6 TRCN0000492127 CTCAAATGCTCCCGATAGATCCCG pLX_317 41.6% 99.8% 100% V5 558A>G n/a
Download CSV