Transcript: Human NM_001204051.2

Homo sapiens solute carrier family 25 member 27 (SLC25A27), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SLC25A27 (9481)
Length:
2662
CDS:
219..1121

Additional Resources:

NCBI RefSeq record:
NM_001204051.2
NBCI Gene record:
SLC25A27 (9481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419177 ATGAATCAACCACGAGATAAA pLKO_005 987 CDS 100% 13.200 18.480 N SLC25A27 n/a
2 TRCN0000429150 TCATTGTTAAAGCGTACATAC pLKO_005 1403 3UTR 100% 10.800 15.120 N SLC25A27 n/a
3 TRCN0000044348 CGAGAGGTTGTGTTTGGCAAA pLKO.1 555 CDS 100% 4.050 5.670 N SLC25A27 n/a
4 TRCN0000044352 GAGCGAGCAAATTCCTACTGT pLKO.1 274 CDS 100% 3.000 2.400 N SLC25A27 n/a
5 TRCN0000429118 TGAAGGATTCATGAGTCTATA pLKO_005 1067 CDS 100% 13.200 9.240 N SLC25A27 n/a
6 TRCN0000424296 TTTGGCCTTTGAGTTGCTATT pLKO_005 1217 3UTR 100% 10.800 7.560 N SLC25A27 n/a
7 TRCN0000044351 CCCGCCATTTACAGACACGTA pLKO.1 495 CDS 100% 2.640 1.848 N SLC25A27 n/a
8 TRCN0000044350 CTAGGGATCATTGAAGAGGAA pLKO.1 444 CDS 100% 2.640 1.848 N SLC25A27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11373 pDONR223 100% 80.5% 78.6% None (many diffs) n/a
2 ccsbBroad304_11373 pLX_304 0% 80.5% 78.6% V5 (many diffs) n/a
3 TRCN0000480941 CCACAACAACTAAGACATCGCGAA pLX_317 52.3% 80.5% 78.6% V5 (many diffs) n/a
Download CSV