Transcript: Human NM_001204112.2

Homo sapiens BCL2 like 11 (BCL2L11), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
BCL2L11 (10018)
Length:
4939
CDS:
289..531

Additional Resources:

NCBI RefSeq record:
NM_001204112.2
NBCI Gene record:
BCL2L11 (10018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001053 ACGAATGGTTATCTTACGACT pLKO.1 666 3UTR 100% 2.640 3.696 N BCL2L11 n/a
2 TRCN0000001054 AGCCGAAGACCACCCACGAAT pLKO.1 651 3UTR 100% 1.650 2.310 N BCL2L11 n/a
3 TRCN0000355973 TACGACTGTTACGTTACATTG pLKO_005 680 3UTR 100% 10.800 8.640 N BCL2L11 n/a
4 TRCN0000367677 GACCACCCACGAATGGTTATC pLKO_005 658 3UTR 100% 10.800 7.560 N BCL2L11 n/a
5 TRCN0000001051 ATGGTTATCTTACGACTGTTA pLKO.1 670 3UTR 100% 4.950 3.465 N BCL2L11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02292 pDONR223 100% 38.8% 36.8% None (many diffs) n/a
2 ccsbBroad304_02292 pLX_304 88.4% 38.8% 36.8% V5 (many diffs) n/a
3 TRCN0000469407 GTCTAGTATATTAGGCACTTGCCG pLX_317 65.9% 38.8% 36.8% V5 (many diffs) n/a
Download CSV