Transcript: Human NM_001204255.2

Homo sapiens scavenger receptor class B member 2 (SCARB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SCARB2 (950)
Length:
4265
CDS:
282..1289

Additional Resources:

NCBI RefSeq record:
NM_001204255.2
NBCI Gene record:
SCARB2 (950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029252 CGGTATAAAGTTCCTGCAGAA pLKO.1 732 CDS 100% 4.050 5.670 N SCARB2 n/a
2 TRCN0000352967 CGGTATAAAGTTCCTGCAGAA pLKO_005 732 CDS 100% 4.050 5.670 N SCARB2 n/a
3 TRCN0000029251 GACCAGAGTATCGAGAAGAAA pLKO.1 381 CDS 100% 5.625 3.938 N SCARB2 n/a
4 TRCN0000343904 GACCAGAGTATCGAGAAGAAA pLKO_005 381 CDS 100% 5.625 3.938 N SCARB2 n/a
5 TRCN0000029250 CCTCAATGAGAGTGTTCACAT pLKO.1 1082 CDS 100% 4.950 3.465 N SCARB2 n/a
6 TRCN0000343905 CCTCAATGAGAGTGTTCACAT pLKO_005 1082 CDS 100% 4.950 3.465 N SCARB2 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3518 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3387 3UTR 100% 2.640 1.320 Y LINC01098 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3518 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00257 pDONR223 100% 70% 70% None 275_276ins429 n/a
2 ccsbBroad304_00257 pLX_304 0% 70% 70% V5 275_276ins429 n/a
3 TRCN0000479790 TTTATTTCGGACAGGATTGCCTGA pLX_317 23.1% 70% 70% V5 275_276ins429 n/a
Download CSV