Transcript: Human NM_001204265.2

Homo sapiens nuclear receptor subfamily 3 group C member 1 (NR3C1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
NR3C1 (2908)
Length:
4101
CDS:
490..2520

Additional Resources:

NCBI RefSeq record:
NM_001204265.2
NBCI Gene record:
NR3C1 (2908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222129 GAAGTGTTATATGCAGGATAT pLKO.1 2113 CDS 100% 10.800 15.120 N NR3C1 n/a
2 TRCN0000245003 GCGGGAGAAGACGATTCATTC pLKO_005 1174 CDS 100% 10.800 15.120 N NR3C1 n/a
3 TRCN0000222127 CGGTGGCAATGTGAAATTGTA pLKO.1 1020 CDS 100% 5.625 4.500 N NR3C1 n/a
4 TRCN0000238461 TTTGCTCCTGATCTGATTATT pLKO_005 2356 CDS 100% 15.000 10.500 N Nr3c1 n/a
5 TRCN0000245005 CACAGGCTTCAGGTATCTTAT pLKO_005 2449 CDS 100% 13.200 9.240 N NR3C1 n/a
6 TRCN0000222126 CCAGCATGAGACCAGATGTAA pLKO.1 1676 CDS 100% 5.625 3.938 N NR3C1 n/a
7 TRCN0000222125 CCTGGATGTTTCTTATGGCAT pLKO.1 2285 CDS 100% 2.640 1.848 N NR3C1 n/a
8 TRCN0000245004 GTGTCACTGTTGGAGGTTATT pLKO_005 2086 CDS 100% 13.200 7.920 N NR3C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00693 pDONR223 100% 86.9% 86.7% None 2023delG;2026_2027insCCTAA;2028_2029ins299 n/a
2 ccsbBroad304_00693 pLX_304 0% 86.9% 86.7% V5 2023delG;2026_2027insCCTAA;2028_2029ins299 n/a
3 TRCN0000469869 CTCAGCCACGCCAAAACGTATTAA pLX_317 16.6% 86.9% 86.7% V5 2023delG;2026_2027insCCTAA;2028_2029ins299 n/a
4 TRCN0000488070 CTCCATCCTAACTGATTCTATTAG pLX_317 14.5% 86.8% 86.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV