Transcript: Human NM_001204368.2

Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MGST2 (4258)
Length:
669
CDS:
202..435

Additional Resources:

NCBI RefSeq record:
NM_001204368.2
NBCI Gene record:
MGST2 (4258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152420 CATATATGGCCGTCACCTATA pLKO.1 388 CDS 100% 10.800 15.120 N MGST2 n/a
2 TRCN0000278432 CATATATGGCCGTCACCTATA pLKO_005 388 CDS 100% 10.800 15.120 N MGST2 n/a
3 TRCN0000152555 GCAAGTTGGAAAGGCAAGATT pLKO.1 273 CDS 100% 5.625 3.938 N MGST2 n/a
4 TRCN0000278430 GCAAGTTGGAAAGGCAAGATT pLKO_005 273 CDS 100% 5.625 3.938 N MGST2 n/a
5 TRCN0000150912 GATGAATATCTGGACCTCAAT pLKO.1 524 3UTR 100% 4.950 3.465 N MGST2 n/a
6 TRCN0000297455 GATGAATATCTGGACCTCAAT pLKO_005 524 3UTR 100% 4.950 3.465 N MGST2 n/a
7 TRCN0000152898 GCAAACAGCTTTCTGGATGAA pLKO.1 509 3UTR 100% 4.950 3.465 N MGST2 n/a
8 TRCN0000155842 CCTGGGAATTGCAAACAGCTT pLKO.1 499 3UTR 100% 2.640 1.848 N MGST2 n/a
9 TRCN0000352900 CCTGGGAATTGCAAACAGCTT pLKO_005 499 3UTR 100% 2.640 1.848 N MGST2 n/a
10 TRCN0000155332 GAGAGAGTATTTCGGGCACAA pLKO.1 340 CDS 100% 4.050 3.240 N MGST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01010 pDONR223 100% 52.3% 37.5% None 158_159ins71;231_232ins139 n/a
2 ccsbBroad304_01010 pLX_304 0% 52.3% 37.5% V5 158_159ins71;231_232ins139 n/a
3 TRCN0000480569 AACCCTTTCACATTTGCCTTCATC pLX_317 81.1% 52.3% 37.5% V5 158_159ins71;231_232ins139 n/a
Download CSV