Transcript: Human NM_001204410.1

Homo sapiens SEC14 like lipid binding 1 (SEC14L1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SEC14L1 (6397)
Length:
5584
CDS:
359..2506

Additional Resources:

NCBI RefSeq record:
NM_001204410.1
NBCI Gene record:
SEC14L1 (6397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303632 TCCAATCGGGTCATCATTAAT pLKO_005 665 CDS 100% 15.000 21.000 N SEC14L1 n/a
2 TRCN0000303633 TTGACGTGGTCTCAGATATTG pLKO_005 2800 3UTR 100% 13.200 10.560 N SEC14L1 n/a
3 TRCN0000060150 GCAGGAGTTGATTATGTTTAT pLKO.1 575 CDS 100% 13.200 7.920 N SEC14L1 n/a
4 TRCN0000299467 GCAGGAGTTGATTATGTTTAT pLKO_005 575 CDS 100% 13.200 7.920 N SEC14L1 n/a
5 TRCN0000060149 GCACAAGTGTAAAGTGATGTA pLKO.1 2347 CDS 100% 4.950 2.970 N SEC14L1 n/a
6 TRCN0000299466 GCACAAGTGTAAAGTGATGTA pLKO_005 2347 CDS 100% 4.950 2.970 N SEC14L1 n/a
7 TRCN0000060151 GTTCCTCATTTATGCAGGAAA pLKO.1 1735 CDS 100% 0.495 0.297 N SEC14L1 n/a
8 TRCN0000299468 GTTCCTCATTTATGCAGGAAA pLKO_005 1735 CDS 100% 0.495 0.297 N SEC14L1 n/a
9 TRCN0000102198 CGACTACATCAAGAGATACTT pLKO.1 1081 CDS 100% 5.625 3.375 N Sec14l1 n/a
10 TRCN0000323632 CGACTACATCAAGAGATACTT pLKO_005 1081 CDS 100% 5.625 3.375 N Sec14l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10444 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_10444 pLX_304 0% 99.7% 99.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000491645 TCCCGACTAGAATAAACCTGTGTT pLX_317 18.6% 99.7% 99.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV