Transcript: Mouse NM_001205030.1

Mus musculus predicted gene 11568 (Gm11568), mRNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
Gm11568 (432600)
Length:
1144
CDS:
55..690

Additional Resources:

NCBI RefSeq record:
NM_001205030.1
NBCI Gene record:
Gm11568 (432600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098437 GCTGGAGACCAAGCTGTGTGA pLKO.1 125 CDS 100% 0.880 0.440 Y Krtap9-1 n/a
2 TRCN0000098439 CCAGGTGCTGTATCTCCAGCT pLKO.1 431 CDS 100% 0.720 0.360 Y Krtap9-1 n/a
3 TRCN0000098438 CCAGCTGTTGTCAGTCCAGCT pLKO.1 326 CDS 100% 0.072 0.036 Y Krtap9-1 n/a
4 TRCN0000098435 AGCCTTGCTGTCAAACCACTT pLKO.1 200 CDS 100% 4.050 2.025 Y Krtap9-1 n/a
5 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 288 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
6 TRCN0000098464 GCTGCTGCAAGCCCTGCTGTT pLKO.1 521 CDS 100% 0.000 0.000 Y Krtap5-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15184 pDONR223 61.6% 61.4% 48.4% None (many diffs) n/a
2 ccsbBroad304_15184 pLX_304 0% 61.4% 48.4% V5 (many diffs) n/a
3 TRCN0000476293 GATTTATAGACGAGAGCGAATCTG pLX_317 100% 33.9% 29.8% V5 (many diffs) n/a
4 TRCN0000479599 AGTGGAAAGGCTAATTTGGGTACC pLX_317 100% 33.9% 29.8% V5 (many diffs) n/a
Download CSV