Transcript: Human NM_001205247.2

Homo sapiens acyl-CoA synthetase long chain family member 6 (ACSL6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSL6 (23305)
Length:
6430
CDS:
106..2169

Additional Resources:

NCBI RefSeq record:
NM_001205247.2
NBCI Gene record:
ACSL6 (23305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045917 GCATGCACTGATCAGTTTATT pLKO.1 505 CDS 100% 15.000 21.000 N ACSL6 n/a
2 TRCN0000417029 CAATGTTCACAGAACTATTAA pLKO_005 2462 3UTR 100% 15.000 10.500 N ACSL6 n/a
3 TRCN0000045913 CCAGGCAAACACACCATTAAA pLKO.1 1212 CDS 100% 15.000 10.500 N ACSL6 n/a
4 TRCN0000426649 TAATGAACTGTCTAGCAATAT pLKO_005 2195 3UTR 100% 13.200 9.240 N ACSL6 n/a
5 TRCN0000418072 TGGTGCAGTCTGTCGTCTATT pLKO_005 1061 CDS 100% 13.200 9.240 N ACSL6 n/a
6 TRCN0000417643 AGCTACTTACCCACTACTATG pLKO_005 314 CDS 100% 10.800 7.560 N ACSL6 n/a
7 TRCN0000422980 GGTGTATAGAATCATGCTAAA pLKO_005 2632 3UTR 100% 10.800 7.560 N ACSL6 n/a
8 TRCN0000045915 GCTATCCGCTACATCATCAAT pLKO.1 628 CDS 100% 5.625 3.938 N ACSL6 n/a
9 TRCN0000045916 CGGAGTGGAATCATCAGGAAT pLKO.1 1279 CDS 100% 4.950 3.465 N ACSL6 n/a
10 TRCN0000045914 GCAGGTTAAAGCCATTCACAT pLKO.1 2028 CDS 100% 4.950 3.465 N ACSL6 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4537 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11716 pDONR223 100% 90.3% 90.3% None (many diffs) n/a
2 ccsbBroad304_11716 pLX_304 0% 90.3% 90.3% V5 (many diffs) n/a
3 TRCN0000479244 CACACGAATACCCCGGTTTGGTAC pLX_317 6.5% 90.3% 90.3% V5 (many diffs) n/a
Download CSV