Transcript: Human NM_001205262.3

Homo sapiens RAD54 homolog B (RAD54B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RAD54B (25788)
Length:
5376
CDS:
132..485

Additional Resources:

NCBI RefSeq record:
NM_001205262.3
NBCI Gene record:
RAD54B (25788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051309 GCAACATTAGATCCACCTCAT pLKO.1 411 CDS 100% 4.050 5.670 N RAD54B n/a
2 TRCN0000330064 GCACCTACACTGGCAACATTA pLKO_005 399 CDS 100% 13.200 9.240 N RAD54B n/a
3 TRCN0000107080 GCATGATCTACCTGAATATAA pLKO.1 931 3UTR 100% 15.000 7.500 Y RAD54B n/a
4 TRCN0000107081 GAACACTTTAGGTCACTATTA pLKO.1 728 3UTR 100% 13.200 6.600 Y RAD54B n/a
5 TRCN0000107084 CCTCTGTTGATATGAGAATGA pLKO.1 651 3UTR 100% 4.950 2.475 Y RAD54B n/a
6 TRCN0000107082 GTGAACACTTTAGGTCACTAT pLKO.1 726 3UTR 100% 4.950 2.475 Y RAD54B n/a
7 TRCN0000107083 CAGGTAATGTTGGATCACCAT pLKO.1 479 CDS 100% 2.640 1.320 Y RAD54B n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3018 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2888 3UTR 100% 2.640 1.320 Y LINC01098 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3018 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02852 pDONR223 100% 12.3% 11.2% None (many diffs) n/a
2 ccsbBroad304_02852 pLX_304 0% 12.3% 11.2% V5 (many diffs) n/a
3 TRCN0000469488 ATCCGTGACTGCGCTGCTGCGTGG pLX_317 17% 12.3% 11.2% V5 (many diffs) n/a
Download CSV