Transcript: Human NM_001205263.2

Homo sapiens RAD54 homolog B (RAD54B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RAD54B (25788)
Length:
3089
CDS:
699..2879

Additional Resources:

NCBI RefSeq record:
NM_001205263.2
NBCI Gene record:
RAD54B (25788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330063 ATGACCCATATACGCCAAATT pLKO_005 910 CDS 100% 13.200 18.480 N RAD54B n/a
2 TRCN0000330138 ATGGAGGCAAGCCAGTAATAA pLKO_005 1192 CDS 100% 15.000 10.500 N RAD54B n/a
3 TRCN0000051310 CCCTGGATCAAATTAAGAATA pLKO.1 1393 CDS 100% 13.200 9.240 N RAD54B n/a
4 TRCN0000051312 GCAGATTGTTGATGGCTTTAA pLKO.1 2246 CDS 100% 13.200 9.240 N RAD54B n/a
5 TRCN0000330066 GACATTCCATTGCTCTTCTTT pLKO_005 2895 3UTR 100% 5.625 3.938 N RAD54B n/a
6 TRCN0000051308 CCAGAAATCTAACTCCCTGAA pLKO.1 2717 CDS 100% 4.050 2.835 N RAD54B n/a
7 TRCN0000051311 GCTTTATCGAAAGCTGTTAAA pLKO.1 1817 CDS 100% 1.320 0.924 N RAD54B n/a
8 TRCN0000330065 CTTCGTTCCCTGGATCAAATT pLKO_005 1386 CDS 100% 13.200 7.920 N RAD54B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02852 pDONR223 100% 79.7% 79.7% None 0_1ins552 n/a
2 ccsbBroad304_02852 pLX_304 0% 79.7% 79.7% V5 0_1ins552 n/a
3 TRCN0000469488 ATCCGTGACTGCGCTGCTGCGTGG pLX_317 17% 79.7% 79.7% V5 0_1ins552 n/a
Download CSV