Transcript: Human NM_001206683.1

Homo sapiens activating transcription factor 7 (ATF7), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
ATF7 (11016)
Length:
776
CDS:
68..421

Additional Resources:

NCBI RefSeq record:
NM_001206683.1
NBCI Gene record:
ATF7 (11016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086247 CAGTCATCATTGCAGATCAAA pLKO.1 198 CDS 100% 5.625 2.813 Y Atf7 n/a
2 TRCN0000017114 CCGAACTGACTCAGTCATCAT pLKO.1 187 CDS 100% 4.950 2.475 Y ATF7 n/a
3 TRCN0000274351 CCGAACTGACTCAGTCATCAT pLKO_005 187 CDS 100% 4.950 2.475 Y ATF7 n/a
4 TRCN0000017115 GCAGTTCATAAACACAAGCAT pLKO.1 140 CDS 100% 3.000 1.500 Y ATF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15736 pDONR223 0% 99.4% 99.1% None 34C>A;129C>T n/a
2 ccsbBroad304_15736 pLX_304 0% 99.4% 99.1% V5 34C>A;129C>T n/a
3 TRCN0000492204 CCGAACACCCTCTAACTCGGCCTC pLX_317 100% 99.4% 99.1% V5 34C>A;129C>T n/a
Download CSV