Transcript: Human NM_001206978.2

Homo sapiens nuclear receptor subfamily 1 group H member 4 (NR1H4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NR1H4 (9971)
Length:
2586
CDS:
384..1661

Additional Resources:

NCBI RefSeq record:
NM_001206978.2
NBCI Gene record:
NR1H4 (9971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021604 GCCTCTGGATACCACTATAAT pLKO.1 783 CDS 100% 15.000 21.000 N NR1H4 n/a
2 TRCN0000425622 AGTGGAACCATACTCGCAATA pLKO_005 509 CDS 100% 10.800 15.120 N NR1H4 n/a
3 TRCN0000428528 ATGCAGATCAGACCGTGAATG pLKO_005 886 CDS 100% 10.800 15.120 N NR1H4 n/a
4 TRCN0000021608 GCCTCAGGAAATAACAAATAA pLKO.1 1037 CDS 100% 15.000 10.500 N NR1H4 n/a
5 TRCN0000021606 CCCAAGTTCAACCACAGATTT pLKO.1 547 CDS 100% 13.200 9.240 N NR1H4 n/a
6 TRCN0000021607 CCACTTCTTGATGTGCTACAA pLKO.1 1470 CDS 100% 4.950 3.465 N NR1H4 n/a
7 TRCN0000021605 GCCTGACTGAATTACGGACAT pLKO.1 1549 CDS 100% 4.050 2.835 N NR1H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487815 AATGACCCCCAGAGAGCGCTTGTC pLX_317 21.5% 90% 90% V5 (not translated due to prior stop codon) 445_446ins141 n/a
2 TRCN0000487841 CATACGGGGACCCGAGTTGCTATC pLX_317 17.4% 89.9% 89.8% V5 445_446ins141;600A>G;1275_1276insG n/a
3 ccsbBroadEn_11439 pDONR223 100% 89.2% 89.2% None 443_444ins153 n/a
4 ccsbBroad304_11439 pLX_304 0% 89.2% 89.2% V5 443_444ins153 n/a
5 TRCN0000478769 CCTGCACGGCTATTCGTGCAAAGC pLX_317 26.7% 89.2% 89.2% V5 443_444ins153 n/a
Download CSV