Transcript: Human NM_001236.4

Homo sapiens carbonyl reductase 3 (CBR3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CBR3 (874)
Length:
998
CDS:
115..948

Additional Resources:

NCBI RefSeq record:
NM_001236.4
NBCI Gene record:
CBR3 (874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244927 CAACGAGTTACTGCCGATAAT pLKO_005 480 CDS 100% 13.200 18.480 N CBR3 n/a
2 TRCN0000046363 GCAACGAGTTACTGCCGATAA pLKO.1 479 CDS 100% 10.800 15.120 N CBR3 n/a
3 TRCN0000244928 CATGGGAGAGTGGTGAATATC pLKO_005 508 CDS 100% 13.200 9.240 N CBR3 n/a
4 TRCN0000244929 CTGACAGGATTCTGGTGAATG pLKO_005 767 CDS 100% 10.800 7.560 N CBR3 n/a
5 TRCN0000046364 CGTCTGGATGAGAAGAGGAAA pLKO.1 745 CDS 100% 4.950 3.465 N CBR3 n/a
6 TRCN0000046367 GCTCAACGTACTGGTCAACAA pLKO.1 363 CDS 100% 4.950 3.465 N CBR3 n/a
7 TRCN0000046366 GCTGACAGGATTCTGGTGAAT pLKO.1 766 CDS 100% 4.950 3.465 N CBR3 n/a
8 TRCN0000046365 CCTTCAAGAGTGATGATCCAA pLKO.1 395 CDS 100% 3.000 2.100 N CBR3 n/a
9 TRCN0000244926 GATGACACTGAAGACAAATTT pLKO_005 438 CDS 100% 15.000 9.000 N CBR3 n/a
10 TRCN0000244925 TCCAATGCCCTTTGACATTAA pLKO_005 411 CDS 100% 13.200 7.920 N CBR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001236.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05941 pDONR223 100% 99.7% 100% None 255C>T;606G>A n/a
2 ccsbBroad304_05941 pLX_304 0% 99.7% 100% V5 255C>T;606G>A n/a
3 TRCN0000491710 CAAGGAAAAAAATGGTCTAGTTTC pLX_317 38.8% 99.7% 100% V5 255C>T;606G>A n/a
Download CSV