Transcript: Human NM_001237.5

Homo sapiens cyclin A2 (CCNA2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CCNA2 (890)
Length:
2748
CDS:
256..1554

Additional Resources:

NCBI RefSeq record:
NM_001237.5
NBCI Gene record:
CCNA2 (890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001237.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293912 CAACCCACCAGAGACACTAAA pLKO_005 1527 CDS 100% 13.200 18.480 N CCNA2 n/a
2 TRCN0000293951 CAGACTACCATGAGGATATTC pLKO_005 782 CDS 100% 13.200 18.480 N CCNA2 n/a
3 TRCN0000045285 CCTCTTGATTATCCAATGGAT pLKO.1 682 CDS 100% 3.000 4.200 N CCNA2 n/a
4 TRCN0000286479 CCTCTTGATTATCCAATGGAT pLKO_005 682 CDS 100% 3.000 4.200 N CCNA2 n/a
5 TRCN0000293914 ATATACCCTGGAAAGTCTTAA pLKO_005 1398 CDS 100% 13.200 10.560 N CCNA2 n/a
6 TRCN0000293913 TCCTAAGCAACTGGATCAATT pLKO_005 1963 3UTR 100% 13.200 9.240 N CCNA2 n/a
7 TRCN0000045284 CCTTAGGGAAATGGAGGTTAA pLKO.1 810 CDS 100% 10.800 7.560 N CCNA2 n/a
8 TRCN0000045283 GCTGACCCATACCTCAAGTAT pLKO.1 1285 CDS 100% 5.625 3.938 N CCNA2 n/a
9 TRCN0000045286 GCCTGAATCATTAATACGAAA pLKO.1 1371 CDS 100% 4.950 3.465 N CCNA2 n/a
10 TRCN0000045287 GCTCCAACAGTAAATCAGTTT pLKO.1 1177 CDS 100% 4.950 3.465 N CCNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001237.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05946 pDONR223 100% 99.8% 2.7% None 37G>T;487A>G n/a
2 ccsbBroad304_05946 pLX_304 0% 99.8% 2.7% V5 (not translated due to prior stop codon) 37G>T;487A>G n/a
3 TRCN0000476985 AGTCCTGTTTTAACGAGAATCACA pLX_317 18.1% 99.8% 2.7% V5 (not translated due to prior stop codon) 37G>T;487A>G n/a
Download CSV