Transcript: Human NM_001242318.3

Homo sapiens phosphodiesterase 7A (PDE7A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PDE7A (5150)
Length:
6961
CDS:
557..2005

Additional Resources:

NCBI RefSeq record:
NM_001242318.3
NBCI Gene record:
PDE7A (5150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414274 ATGTCGGACGTGGGAATTAAG pLKO_005 1654 CDS 100% 13.200 18.480 N PDE7A n/a
2 TRCN0000434579 GATCGTCACACTGAATCTATT pLKO_005 1763 CDS 100% 13.200 18.480 N PDE7A n/a
3 TRCN0000418345 TAATTGCAAGACCCGAACATA pLKO_005 2176 3UTR 100% 5.625 7.875 N PDE7A n/a
4 TRCN0000412425 ATTTCCTCTGTTGGATCATTT pLKO_005 2143 3UTR 100% 13.200 10.560 N PDE7A n/a
5 TRCN0000435894 GGCCATGCACTGTTACTTAAA pLKO_005 1222 CDS 100% 13.200 10.560 N PDE7A n/a
6 TRCN0000420684 AGAGGTTCTCACCCATATATT pLKO_005 800 CDS 100% 15.000 10.500 N PDE7A n/a
7 TRCN0000415893 GATATCTTGCTGAGCTTAATT pLKO_005 1277 CDS 100% 15.000 10.500 N PDE7A n/a
8 TRCN0000430198 ACCATTACTTGGCAACTTTAT pLKO_005 1359 CDS 100% 13.200 9.240 N PDE7A n/a
9 TRCN0000421950 ATGATGAAACTTCGTAGATTT pLKO_005 1127 CDS 100% 13.200 9.240 N PDE7A n/a
10 TRCN0000048864 CCATTTGGATAGAGGTGATTT pLKO.1 1561 CDS 100% 13.200 9.240 N PDE7A n/a
11 TRCN0000421747 GAGATCTGCAGTGGGCTTATT pLKO_005 1414 CDS 100% 13.200 9.240 N PDE7A n/a
12 TRCN0000423791 TAATTGAGTACTTCCATTTAG pLKO_005 1104 CDS 100% 13.200 9.240 N PDE7A n/a
13 TRCN0000416581 TGCGGTTTCAAATTCCCTAAA pLKO_005 937 CDS 100% 10.800 7.560 N PDE7A n/a
14 TRCN0000428622 TTTGGGTGTGAGTCCACTTTG pLKO_005 1741 CDS 100% 10.800 7.560 N PDE7A n/a
15 TRCN0000048865 CGAGCAGGATTTGAATCAGAA pLKO.1 776 CDS 100% 4.950 3.465 N PDE7A n/a
16 TRCN0000048863 GCTACTAAGTTTCCAGCGATA pLKO.1 886 CDS 100% 4.050 2.835 N PDE7A n/a
17 TRCN0000174081 GCTACTAAGTTTCCAGCGATA pLKO.1 886 CDS 100% 4.050 2.835 N PDE7A n/a
18 TRCN0000048867 GCATTATACATTCGTATGCTA pLKO.1 734 CDS 100% 3.000 2.100 N PDE7A n/a
19 TRCN0000435496 GAAATAGTCTAGTAAGCTTAA pLKO_005 1056 CDS 100% 10.800 6.480 N PDE7A n/a
20 TRCN0000048866 CACAGTTATTACCTCAGGAAA pLKO.1 1971 CDS 100% 4.950 2.970 N PDE7A n/a
21 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5637 3UTR 100% 4.950 2.475 Y CFLAR n/a
22 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5637 3UTR 100% 4.950 2.475 Y C19orf31 n/a
23 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5635 3UTR 100% 4.950 2.475 Y ERN2 n/a
24 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5635 3UTR 100% 4.950 2.475 Y P3H4 n/a
25 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5635 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01161 pDONR223 100% 93.1% 89.6% None (many diffs) n/a
2 ccsbBroad304_01161 pLX_304 0% 93.1% 89.6% V5 (many diffs) n/a
3 TRCN0000476402 CGCGCCTGTCTGGTGGAAGGCGTC pLX_317 28.9% 93.1% 89.6% V5 (many diffs) n/a
Download CSV