Transcript: Human NM_001242692.2

Homo sapiens solute carrier family 14 member 2 (SLC14A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SLC14A2 (8170)
Length:
4253
CDS:
322..3084

Additional Resources:

NCBI RefSeq record:
NM_001242692.2
NBCI Gene record:
SLC14A2 (8170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042928 GCAGGATTTCACGGCTACAAT pLKO.1 2242 CDS 100% 5.625 7.875 N SLC14A2 n/a
2 TRCN0000070316 CGGAGAAGTTAGACTACTACT pLKO.1 911 CDS 100% 4.950 3.960 N Slc14a2 n/a
3 TRCN0000442370 TTCCTGCTCCTGACGACAAAC pLKO_005 1546 CDS 100% 10.800 7.560 N SLC14A2 n/a
4 TRCN0000042932 CTTCAATATCACTGTGACTTT pLKO.1 2424 CDS 100% 4.950 3.465 N SLC14A2 n/a
5 TRCN0000042929 GCCCTTTGACTCCATCTACTT pLKO.1 2715 CDS 100% 4.950 3.465 N SLC14A2 n/a
6 TRCN0000042930 CCCAGTTCTTTCTAGTGCCTT pLKO.1 972 CDS 100% 2.640 1.848 N SLC14A2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3397 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3398 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07206 pDONR223 100% 99.8% 99.6% None (many diffs) n/a
2 ccsbBroad304_07206 pLX_304 0% 99.8% 99.6% V5 (many diffs) n/a
3 TRCN0000475534 TTTGGTTTATTTCAGTCCTTCAGC pLX_317 9.9% 99.8% 99.6% V5 (many diffs) n/a
Download CSV