Transcript: Human NM_001242704.1

Homo sapiens zinc finger protein 385C (ZNF385C), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
ZNF385C (201181)
Length:
2596
CDS:
1..1275

Additional Resources:

NCBI RefSeq record:
NM_001242704.1
NBCI Gene record:
ZNF385C (201181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148018 GTGAGTATCCTCAAGTCTAAA pLKO.1 1024 CDS 100% 13.200 18.480 N ZNF385C n/a
2 TRCN0000147498 GAGTATCCTCAAGTCTAAACT pLKO.1 1026 CDS 100% 5.625 7.875 N ZNF385C n/a
3 TRCN0000180994 GCCAGAGCTGATTTCCCAATA pLKO.1 1289 3UTR 100% 10.800 7.560 N ZNF385C n/a
4 TRCN0000180337 GCTGTGAGTATCCTCAAGTCT pLKO.1 1021 CDS 100% 3.000 2.100 N ZNF385C n/a
5 TRCN0000181154 CAGGTCAATTCAGAGACCCAA pLKO.1 898 CDS 100% 2.640 1.848 N ZNF385C n/a
6 TRCN0000180871 GAAGCAACTCACCAAGACGTT pLKO.1 1056 CDS 100% 2.640 1.848 N ZNF385C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13387 pDONR223 100% 40.9% 41% None 1_750del;1245C>T n/a
2 ccsbBroad304_13387 pLX_304 0% 40.9% 41% V5 1_750del;1245C>T n/a
3 TRCN0000481069 TGTAAGCGTCCTCGCATTTACTGC pLX_317 76% 40.9% 41% V5 1_750del;1245C>T n/a
Download CSV