Transcript: Human NM_001242793.1

Homo sapiens synaptosome associated protein 91 (SNAP91), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SNAP91 (9892)
Length:
4171
CDS:
114..2747

Additional Resources:

NCBI RefSeq record:
NM_001242793.1
NBCI Gene record:
SNAP91 (9892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379484 CAACGAGACCAATGTTAATAT pLKO_005 260 CDS 100% 15.000 12.000 N SNAP91 n/a
2 TRCN0000152106 CCCAAACTCTTCCCATAAATT pLKO.1 3136 3UTR 100% 15.000 10.500 N SNAP91 n/a
3 TRCN0000379873 GCTACAATGATGGTGTTATTA pLKO_005 742 CDS 100% 15.000 10.500 N SNAP91 n/a
4 TRCN0000382124 GGACCCATTAGCGGATCTTAA pLKO_005 2708 CDS 100% 13.200 9.240 N SNAP91 n/a
5 TRCN0000382467 TGGATCCCATGGTTATGATAT pLKO_005 452 CDS 100% 13.200 9.240 N SNAP91 n/a
6 TRCN0000156678 GCCAGCTTAGTAGGCAATCTT pLKO.1 2307 CDS 100% 5.625 3.938 N SNAP91 n/a
7 TRCN0000151943 CGGATCTTAACATCAAGGATT pLKO.1 2719 CDS 100% 4.950 3.465 N SNAP91 n/a
8 TRCN0000154577 GCTGCTAAAGAGTATGCCAAT pLKO.1 602 CDS 100% 4.050 2.835 N SNAP91 n/a
9 TRCN0000382423 TTGTGTATTGTACGATGTAAA pLKO_005 2973 3UTR 100% 13.200 7.920 N SNAP91 n/a
10 TRCN0000155806 CCAGTACCAAACCCAATACTT pLKO.1 2840 3UTR 100% 5.625 3.375 N SNAP91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11428 pDONR223 100% 67.7% 67.7% None (many diffs) n/a
2 ccsbBroad304_11428 pLX_304 0% 67.7% 67.7% V5 (many diffs) n/a
3 TRCN0000473453 GGCGATTGTAATACATTATATCAC pLX_317 25% 67.7% 67.7% V5 (many diffs) n/a
Download CSV