Construct: ORF TRCN0000473453
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004466.1_s317c1
- Derived from:
- ccsbBroadEn_11428
- DNA Barcode:
- GGCGATTGTAATACATTATATCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SNAP91 (9892)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473453
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001242794.1 | 99% | 99% | 9C>A;11A>G;1786_1800del |
| 2 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011590.2 | 70.5% | 70.3% | (many diffs) |
| 3 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011589.2 | 69.3% | 69.1% | (many diffs) |
| 4 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536276.3 | 68.2% | 68% | (many diffs) |
| 5 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011580.2 | 68.2% | 68% | (many diffs) |
| 6 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011581.2 | 68.2% | 68% | (many diffs) |
| 7 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011582.2 | 68.2% | 68% | (many diffs) |
| 8 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001242793.1 | 67.7% | 67.7% | (many diffs) |
| 9 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011583.1 | 67.6% | 67.5% | (many diffs) |
| 10 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011584.2 | 67.6% | 67.5% | (many diffs) |
| 11 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011585.2 | 67.6% | 67.5% | (many diffs) |
| 12 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011586.1 | 67.6% | 67.5% | (many diffs) |
| 13 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011587.1 | 67.6% | 67.5% | (many diffs) |
| 14 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536275.2 | 67.6% | 67.4% | (many diffs) |
| 15 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011575.1 | 67.6% | 67.4% | (many diffs) |
| 16 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011576.1 | 67.6% | 67.4% | (many diffs) |
| 17 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011577.1 | 67.6% | 67.4% | (many diffs) |
| 18 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536273.3 | 67.4% | 67.3% | (many diffs) |
| 19 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011570.2 | 67.4% | 67.3% | (many diffs) |
| 20 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011571.2 | 67.4% | 67.3% | (many diffs) |
| 21 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011572.2 | 67.4% | 67.3% | (many diffs) |
| 22 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011573.2 | 67.4% | 67.3% | (many diffs) |
| 23 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_024446600.1 | 67.4% | 67.3% | (many diffs) |
| 24 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011579.2 | 67% | 66.8% | (many diffs) |
| 25 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011568.2 | 66.7% | 66.6% | (many diffs) |
| 26 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536271.1 | 66.5% | 66.4% | (many diffs) |
| 27 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011566.2 | 66.5% | 66.4% | (many diffs) |
| 28 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011567.1 | 66.5% | 66.4% | (many diffs) |
| 29 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_024446599.1 | 66.5% | 66.4% | (many diffs) |
| 30 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011563.2 | 66% | 66% | (many diffs) |
| 31 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011564.2 | 66% | 66% | (many diffs) |
| 32 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011565.2 | 66% | 66% | (many diffs) |
| 33 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011569.2 | 65.9% | 65.8% | (many diffs) |
| 34 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011562.2 | 65.8% | 65.7% | (many diffs) |
| 35 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011554.1 | 65.6% | 65.6% | (many diffs) |
| 36 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011555.1 | 65.6% | 65.6% | (many diffs) |
| 37 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011556.1 | 65.6% | 65.6% | (many diffs) |
| 38 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001242792.1 | 65.5% | 65.3% | (many diffs) |
| 39 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_014841.2 | 65.5% | 65.3% | (many diffs) |
| 40 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_005248770.5 | 65.5% | 65.3% | (many diffs) |
| 41 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_006715615.1 | 65.5% | 65.3% | (many diffs) |
| 42 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536265.1 | 65.5% | 65.3% | (many diffs) |
| 43 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536266.1 | 65.5% | 65.3% | (many diffs) |
| 44 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001256717.1 | 65.5% | 64.9% | (many diffs) |
| 45 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001363677.1 | 64.9% | 64.8% | (many diffs) |
| 46 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_011536269.1 | 64.9% | 64.8% | (many diffs) |
| 47 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011557.2 | 64.9% | 64.8% | (many diffs) |
| 48 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011558.1 | 64.9% | 64.8% | (many diffs) |
| 49 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011559.1 | 64.9% | 64.8% | (many diffs) |
| 50 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011560.2 | 64.9% | 64.8% | (many diffs) |
| 51 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_024446601.1 | 63.5% | 63.6% | (many diffs) |
| 52 | human | 9892 | SNAP91 | synaptosome associated prot... | XM_017011574.2 | 63.1% | 63% | (many diffs) |
| 53 | human | 9892 | SNAP91 | synaptosome associated prot... | NM_001256718.1 | 51.9% | 51.8% | (many diffs) |
| 54 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510904.4 | 85.9% | 92% | (many diffs) |
| 55 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510903.4 | 85.6% | 91.5% | (many diffs) |
| 56 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001277985.1 | 82.7% | 88.9% | (many diffs) |
| 57 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_030244159.1 | 81.9% | 87.7% | (many diffs) |
| 58 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510902.4 | 62.7% | 66.2% | (many diffs) |
| 59 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510901.4 | 61.3% | 64.7% | (many diffs) |
| 60 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_030244157.1 | 61.2% | 64.7% | (many diffs) |
| 61 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001357772.1 | 60.8% | 64.1% | (many diffs) |
| 62 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510899.4 | 60.7% | 64.1% | (many diffs) |
| 63 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_030244155.1 | 59.3% | 62.7% | (many diffs) |
| 64 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_030244156.1 | 59.3% | 62.7% | (many diffs) |
| 65 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510896.4 | 59.2% | 62.5% | (many diffs) |
| 66 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510895.4 | 59% | 62.4% | (many diffs) |
| 67 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001357770.1 | 58.9% | 62.1% | (many diffs) |
| 68 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_013669.2 | 58.9% | 62.1% | (many diffs) |
| 69 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001277983.1 | 58.4% | 61.8% | (many diffs) |
| 70 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001277986.1 | 58.4% | 61.6% | (many diffs) |
| 71 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_017313237.2 | 58% | 61.2% | (many diffs) |
| 72 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510897.2 | 56.6% | 59.9% | (many diffs) |
| 73 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510898.4 | 56.2% | 59.3% | (many diffs) |
| 74 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001277982.2 | 55.7% | 58.7% | (many diffs) |
| 75 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_006510900.3 | 55.7% | 58.7% | (many diffs) |
| 76 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | NM_001357768.1 | 54.9% | 34.2% | (many diffs) |
| 77 | mouse | 20616 | Snap91 | synaptosomal-associated pro... | XM_030244158.1 | 53.9% | 57% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1851
- ORF length:
- 1785
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gggacgaacg ctcacggatc ggatcgccgc cgctcagtac agcgttacag 121 gctctgctgt agcaagagcg gtctgcaaag ccactactca tgaagtaatg ggccccaaga 181 aaaagcacct ggactatttg atccaggcta ccaacgagac caatgttaat attcctcaga 241 tggccgacac tctctttgag cgggcaacaa acagtagctg ggtggttgtg tttaaggctt 301 tagtgacaac acatcatctc atggtgcatg gaaatgagag atttattcaa tatttggctt 361 ctagaaatac actattcaat ctcagcaatt ttttggacaa aagtggatcc catggttatg 421 atatgtctac cttcataagg cgctatagta gatatttgaa tgaaaaggct ttttcttaca 481 gacagatggc ctttgatttt gccagggtga agaaaggggc cgatggtgta atgaggacaa 541 tggctcccga aaagctgcta aagagtatgc caatactaca gggacaaatt gatgcactgc 601 ttgaatttga tgtgcatcca aatgaactaa caaatggtgt cataaatgca gcatttatgc 661 ttcttttcaa agatcttatc aaactttttg cttgctacaa tgatggtgtt attaacttac 721 tcgaaaagtt ttttgaaatg aagaaaggac aatgtaaaga tgctctagaa atttacaaac 781 gatttctaac tagaatgaca cgagtgtctg aatttctcaa ggttgcagag gctcccagca 841 gtcttatgga gacgcttgaa cagcatctaa atacattaga aggaaagaaa cctggaaaca 901 aatctggtgc tccctctcca ttaagtaagt cttctccagc cacaactgtt acgtctccta 961 attctacacc agctaaaact attgacacat ccccaccggt tgatttattt gcaactgcat 1021 ctgcggctgt cccagtcagc acttctaaac catctagtga tctcctggac ctccagccag 1081 acttttcctc tggaggggca gcagcagccg cagcaccagc accaccacca cctgctggag 1141 gagccactgc atggggagga tttgggggtt ctttcatggc gccttcccca tctccagtga 1201 ctccagctca gaataacctg ctacagccca attttgaggc agcttttggg acaacgcctt 1261 caacttccag cagcagctcc tttgatccat cagtgtttga tggtctaggt gatcttttga 1321 tgccaaccat ggcaccagct gggcagcctg cacctgtctc aatggtacca cccagtcctg 1381 caatggcagc cagcaaagcc cttggaagtg atcttgattc aTCTCTTGCC AGCTTAGTAG 1441 GCAATCTTGG AATTTCTGGT ACCACAACAA AAAAGGGAGA TCTTCAGTGG AATGCTGGAG 1501 AGAAAAAGTT GACTGGTGGA GCCAACTGGC AGCCTAAAGT AGCTCCAGCA ACCTGGTCAG 1561 CAGGCGTTCC ACCAAGTGCA CCTTTGCAAG GAGCTGTACC TCCAACCAGT TCAGTTCCTC 1621 CTGTTGCCGG GGCCCCATCG GTTGGACAAC CTGGAGCAGG ATTTGGAATG CCTCCTGCTG 1681 GGACAGGCAT GCCCATGATG CCTCAGCAGC CGGTCATGTT TGCACAGCCC ATGATGAGGC 1741 CCCCCTTTGG AGCTGCCGCT GTACCTGGCA CGCAGCTTTC TCCAAGCCCT ACACCTGCCA 1801 GTCAGAGTCC CAAGAAACCT CCAGCAAAGG ACCCATTAGC GGATCTTAAC ATCAAGGATT 1861 TCTTGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1921 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1981 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGGCGATTGT AATACATTAT ATCACACGCG 2041 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt