Transcript: Human NM_001243094.2

Homo sapiens heat shock transcription factor 2 (HSF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HSF2 (3298)
Length:
955
CDS:
87..779

Additional Resources:

NCBI RefSeq record:
NM_001243094.2
NBCI Gene record:
HSF2 (3298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020201 CGAAAGATTGTCCAGTTTATT pLKO.1 612 CDS 100% 15.000 12.000 N HSF2 n/a
2 TRCN0000422223 TATCGACTCTGGAATTGTAAA pLKO_005 311 CDS 100% 13.200 10.560 N HSF2 n/a
3 TRCN0000425149 GACTTGTTGGAGAACATTAAA pLKO_005 390 CDS 100% 15.000 10.500 N HSF2 n/a
4 TRCN0000428715 TAACCAACTTGTGAGTTTAAA pLKO_005 650 CDS 100% 15.000 10.500 N HSF2 n/a
5 TRCN0000420280 TGTTTCAGCACATAGTCAAAG pLKO_005 721 CDS 100% 10.800 7.560 N HSF2 n/a
6 TRCN0000020202 CCCAAATATTTCAAGCACAAT pLKO.1 234 CDS 100% 4.950 2.970 N HSF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243094.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10891 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10891 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470234 GATCAAGAACGCCAGGATTCAGCC pLX_317 51.1% 100% 100% V5 n/a
4 ccsbBroadEn_00795 pDONR223 100% 42.7% 42.5% None 683_684insTCCACACAGTAGGACTG;686_687delTTinsGG;690_691ins901 n/a
5 ccsbBroad304_00795 pLX_304 0% 42.7% 42.5% V5 683_684insTCCACACAGTAGGACTG;686_687delTTinsGG;690_691ins901 n/a
Download CSV