Transcript: Human NM_001243246.1

Homo sapiens prolyl 3-hydroxylase 1 (P3H1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
P3H1 (64175)
Length:
3115
CDS:
114..2528

Additional Resources:

NCBI RefSeq record:
NM_001243246.1
NBCI Gene record:
P3H1 (64175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425639 GCGCATCATGGAGTCCTACTT pLKO_005 1751 CDS 100% 4.950 6.930 N P3H1 n/a
2 TRCN0000064878 GCCTACTATAACATTGGGAAT pLKO.1 1041 CDS 100% 4.050 5.670 N P3H1 n/a
3 TRCN0000064881 CCTAGACTATTACCAAACCAT pLKO.1 659 CDS 100% 3.000 4.200 N P3H1 n/a
4 TRCN0000064880 CCCTGTCATTATGGTCACATT pLKO.1 2311 CDS 100% 4.950 3.960 N P3H1 n/a
5 TRCN0000436890 AGACCCTCGTGTGTGTCAAAG pLKO_005 1900 CDS 100% 10.800 7.560 N P3H1 n/a
6 TRCN0000311322 CAGGCCATCACAGATCATTAC pLKO_005 909 CDS 100% 10.800 7.560 N P3h1 n/a
7 TRCN0000064882 CCCAAGAGATTGCAAGAGAAA pLKO.1 1311 CDS 100% 4.950 3.465 N P3H1 n/a
8 TRCN0000064879 CCAGGCCATCACAGATCATTA pLKO.1 908 CDS 100% 13.200 7.920 N P3H1 n/a
9 TRCN0000413894 GGCAGAGAGGAAGGATGATAG pLKO_005 1841 CDS 100% 10.800 6.480 N P3H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03934 pDONR223 100% 86.5% 86% None (many diffs) n/a
2 ccsbBroad304_03934 pLX_304 0% 86.5% 86% V5 (many diffs) n/a
3 TRCN0000479285 GTTATTAAATGATCAGACCCAAGT pLX_317 19.4% 86.5% 86% V5 (many diffs) n/a
Download CSV