Transcript: Human NM_001243466.2

Homo sapiens StAR related lipid transfer domain containing 13 (STARD13), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
STARD13 (90627)
Length:
2821
CDS:
70..2133

Additional Resources:

NCBI RefSeq record:
NM_001243466.2
NBCI Gene record:
STARD13 (90627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413632 GCTTATGATGTGGCGGATATG pLKO_005 2205 3UTR 100% 10.800 15.120 N STARD13 n/a
2 TRCN0000047845 CCAAGGCACTTTCTATTGAAA pLKO.1 1265 CDS 100% 5.625 4.500 N STARD13 n/a
3 TRCN0000047844 CCCAGTGATGTGGAAAGAGAT pLKO.1 1687 CDS 100% 4.950 2.970 N STARD13 n/a
4 TRCN0000047846 GCCAGAGTCCTTTAAGGCTAT pLKO.1 927 CDS 100% 4.050 2.430 N STARD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12943 pDONR223 100% 99.9% 100% None 1134A>G n/a
2 ccsbBroad304_12943 pLX_304 0% 99.9% 100% V5 1134A>G n/a
3 TRCN0000491352 TCCCAGGAATAGTAAGTTAATGTA pLX_317 16.1% 99.9% 100% V5 1134A>G n/a
Download CSV