Transcript: Human NM_001243473.2

Homo sapiens B9 domain containing 1 (B9D1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
B9D1 (27077)
Length:
1281
CDS:
18..791

Additional Resources:

NCBI RefSeq record:
NM_001243473.2
NBCI Gene record:
B9D1 (27077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275058 CCCATTGATGTCACCTTTAAA pLKO_005 281 CDS 100% 15.000 10.500 N B9D1 n/a
2 TRCN0000275054 AGATCGTGCTCAGCGTGTATG pLKO_005 327 CDS 100% 10.800 7.560 N B9D1 n/a
3 TRCN0000130573 CCATGTTTGTCCCAGAATCTA pLKO.1 435 CDS 100% 5.625 3.938 N B9D1 n/a
4 TRCN0000127613 CCCAGAATCTACGTCTAAACT pLKO.1 445 CDS 100% 5.625 3.938 N B9D1 n/a
5 TRCN0000274988 CCCAGAATCTACGTCTAAACT pLKO_005 445 CDS 100% 5.625 3.938 N B9D1 n/a
6 TRCN0000146509 CTCTACTGCAAGTACTGCTTT pLKO.1 158 CDS 100% 4.950 3.465 N B9D1 n/a
7 TRCN0000274987 CTCTACTGCAAGTACTGCTTT pLKO_005 158 CDS 100% 4.950 3.465 N B9D1 n/a
8 TRCN0000129901 GAAGTTTACAAGCTGGTTCAT pLKO.1 469 CDS 100% 4.950 3.465 N B9D1 n/a
9 TRCN0000149275 GCAGAAGTTTACAAGCTGGTT pLKO.1 466 CDS 100% 2.640 1.848 N B9D1 n/a
10 TRCN0000274990 GCAGAAGTTTACAAGCTGGTT pLKO_005 466 CDS 100% 2.640 1.848 N B9D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14115 pDONR223 100% 52.4% 47.4% None (many diffs) n/a
2 ccsbBroad304_14115 pLX_304 0% 52.4% 47.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474163 CCGATTCCTTGAGGCGATATTTAC pLX_317 85.7% 52.4% 47.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV