Transcript: Human NM_001243564.1

Homo sapiens dehydrodolichyl diphosphate synthase subunit (DHDDS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
DHDDS (79947)
Length:
3238
CDS:
151..1050

Additional Resources:

NCBI RefSeq record:
NM_001243564.1
NBCI Gene record:
DHDDS (79947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432510 GTCTCCCACGAGTACACTAAA pLKO_005 1255 3UTR 100% 13.200 18.480 N DHDDS n/a
2 TRCN0000045573 CCGAAACACATTGCATTCATA pLKO.1 226 CDS 100% 5.625 7.875 N DHDDS n/a
3 TRCN0000045574 CTGCTTGATAAGTGCCTCTAT pLKO.1 607 CDS 100% 4.950 6.930 N DHDDS n/a
4 TRCN0000222663 CCCTACAATTAAGGCGGGAAT pLKO.1 2756 3UTR 100% 4.050 5.670 N Dhdds n/a
5 TRCN0000045577 CCTGACATCTTGATACGGACT pLKO.1 646 CDS 100% 2.160 3.024 N DHDDS n/a
6 TRCN0000434737 ACCTTGGATCTGCTAGTAAAT pLKO_005 1473 3UTR 100% 13.200 10.560 N DHDDS n/a
7 TRCN0000424906 TTCTGTGCCAACATCATAAAG pLKO_005 193 CDS 100% 13.200 9.240 N DHDDS n/a
8 TRCN0000421836 AGAAGGCCCGAGACATGTATG pLKO_005 812 CDS 100% 10.800 7.560 N DHDDS n/a
9 TRCN0000431934 GAAGGACACGCTTGCACAAAC pLKO_005 932 CDS 100% 10.800 7.560 N DHDDS n/a
10 TRCN0000426297 GAGTGAGGTAGACGGGCTTAT pLKO_005 411 CDS 100% 10.800 7.560 N DHDDS n/a
11 TRCN0000076082 CGCATTCAGCATTGAGAACTT pLKO.1 378 CDS 100% 4.950 3.465 N Dhdds n/a
12 TRCN0000302728 CGCATTCAGCATTGAGAACTT pLKO_005 378 CDS 100% 4.950 3.465 N Dhdds n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2323 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2323 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15996 pDONR223 0% 90.4% 89.2% None (many diffs) n/a
2 ccsbBroad304_15996 pLX_304 0% 90.4% 89.2% V5 (many diffs) n/a
3 TRCN0000471314 CTTGTGTTGATGCCGATAGGTAGC pLX_317 43.1% 90.4% 89.2% V5 (many diffs) n/a
4 ccsbBroadEn_08993 pDONR223 100% 89.5% 89.1% None 440_441ins102;564C>T;655G>A n/a
5 ccsbBroad304_08993 pLX_304 0% 89.5% 89.1% V5 440_441ins102;564C>T;655G>A n/a
6 TRCN0000471439 TGGGAAATCCCAAACACACATTTG pLX_317 39.5% 89.5% 89.1% V5 440_441ins102;564C>T;655G>A n/a
Download CSV