Transcript: Human NM_001243646.1

Homo sapiens CD2 cytoplasmic tail binding protein 2 (CD2BP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CD2BP2 (10421)
Length:
3513
CDS:
254..1279

Additional Resources:

NCBI RefSeq record:
NM_001243646.1
NBCI Gene record:
CD2BP2 (10421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310657 CTACTTCCCGGACGGTGTTTA pLKO_005 1186 CDS 100% 13.200 18.480 N CD2BP2 n/a
2 TRCN0000057483 TGTTCGGATCACACCCTTTAA pLKO.1 505 CDS 100% 13.200 18.480 N CD2BP2 n/a
3 TRCN0000057485 GCCGCTTTAAAGGCAAACACT pLKO.1 369 CDS 100% 3.000 4.200 N CD2BP2 n/a
4 TRCN0000291821 GCCGCTTTAAAGGCAAACACT pLKO_005 369 CDS 100% 3.000 4.200 N CD2BP2 n/a
5 TRCN0000303278 GGACTCTGCTTGCCGTGTAAA pLKO_005 1555 3UTR 100% 13.200 9.240 N CD2BP2 n/a
6 TRCN0000057486 GTGGATGTGATGTGGGAATAT pLKO.1 1088 CDS 100% 13.200 9.240 N CD2BP2 n/a
7 TRCN0000307777 GTGGATGTGATGTGGGAATAT pLKO_005 1088 CDS 100% 13.200 9.240 N CD2BP2 n/a
8 TRCN0000381146 TGTCTCAGGCAGCGAGGAAAT pLKO_005 1342 3UTR 100% 10.800 7.560 N CD2BP2 n/a
9 TRCN0000057484 GCATTGACTTTGACCTCTACA pLKO.1 1254 CDS 100% 4.950 3.465 N CD2BP2 n/a
10 TRCN0000291822 GCATTGACTTTGACCTCTACA pLKO_005 1254 CDS 100% 4.950 3.465 N CD2BP2 n/a
11 TRCN0000057487 GTGTACCAGGAAACAAGGGAA pLKO.1 902 CDS 100% 2.640 1.848 N CD2BP2 n/a
12 TRCN0000068035 CCAGGAAACAAGGGAACGGTT pLKO.1 907 CDS 100% 2.640 1.584 N Cd2bp2 n/a
13 TRCN0000335213 CCAGGAAACAAGGGAACGGTT pLKO_005 907 CDS 100% 2.640 1.584 N Cd2bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02423 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02423 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468090 GACACATACGGTGCCATCACTAGA pLX_317 33.4% 100% 100% V5 n/a
Download CSV