Transcript: Human NM_001244604.2

Homo sapiens dihydropyrimidinase like 2 (DPYSL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DPYSL2 (1808)
Length:
4278
CDS:
199..1809

Additional Resources:

NCBI RefSeq record:
NM_001244604.2
NBCI Gene record:
DPYSL2 (1808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046817 CTGAGTGTGATCCGGGATATT pLKO.1 643 CDS 100% 13.200 18.480 N DPYSL2 n/a
2 TRCN0000291881 CTGAGTGTGATCCGGGATATT pLKO_005 643 CDS 100% 13.200 18.480 N DPYSL2 n/a
3 TRCN0000046814 GCTAACGGATTGCCAGATTTA pLKO.1 615 CDS 100% 13.200 18.480 N DPYSL2 n/a
4 TRCN0000291882 GCTAACGGATTGCCAGATTTA pLKO_005 615 CDS 100% 13.200 18.480 N DPYSL2 n/a
5 TRCN0000032643 CCTCGTGTACATGGCTTTCAA pLKO.1 582 CDS 100% 5.625 4.500 N Dpysl2 n/a
6 TRCN0000315566 CCTCGTGTACATGGCTTTCAA pLKO_005 582 CDS 100% 5.625 4.500 N Dpysl2 n/a
7 TRCN0000310403 AGACCAACTGCCCGCTGTATA pLKO_005 824 CDS 100% 13.200 9.240 N DPYSL2 n/a
8 TRCN0000046816 CAGTGCCCATTGCACGTTTAA pLKO.1 1080 CDS 100% 13.200 9.240 N DPYSL2 n/a
9 TRCN0000303301 TTAAGAGCCTGTGATAGTTAC pLKO_005 1910 3UTR 100% 10.800 7.560 N DPYSL2 n/a
10 TRCN0000046813 GCTCAGATTGATGACAACATT pLKO.1 1720 CDS 100% 5.625 3.938 N DPYSL2 n/a
11 TRCN0000046815 GCAGACATATACATGGAAGAT pLKO.1 187 5UTR 100% 4.950 3.465 N DPYSL2 n/a
12 TRCN0000032642 GCAGCCAAAGTCTTCAACCTT pLKO.1 1252 CDS 100% 3.000 2.100 N Dpysl2 n/a
13 TRCN0000331326 AGCCAAAGTCTTCAACCTTTA pLKO_005 1254 CDS 100% 10.800 6.480 N DPYSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00461 pDONR223 100% 93.6% 93.7% None 0_1ins108;318T>C n/a
2 ccsbBroad304_00461 pLX_304 0% 93.6% 93.7% V5 0_1ins108;318T>C n/a
3 TRCN0000478792 GTTGCCATCAACACATTCGCATTT pLX_317 20.2% 93.6% 93.7% V5 0_1ins108;318T>C n/a
Download CSV