Transcript: Human NM_001248.4

Homo sapiens ectonucleoside triphosphate diphosphohydrolase 3 (ENTPD3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ENTPD3 (956)
Length:
2916
CDS:
91..1680

Additional Resources:

NCBI RefSeq record:
NM_001248.4
NBCI Gene record:
ENTPD3 (956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001248.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359354 ATGGATTACAGCCAACTATTT pLKO_005 648 CDS 100% 13.200 18.480 N ENTPD3 n/a
2 TRCN0000359283 CCCTGTTACCCTCGGGATTAT pLKO_005 952 CDS 100% 13.200 18.480 N ENTPD3 n/a
3 TRCN0000050452 CCACTTGTTTGTGAACGGTTA pLKO.1 1377 CDS 100% 4.050 5.670 N ENTPD3 n/a
4 TRCN0000359355 CTACCCACATGCTGATCTATT pLKO_005 1889 3UTR 100% 13.200 9.240 N ENTPD3 n/a
5 TRCN0000050448 CCAAAGATTAAAGGGCCATTT pLKO.1 1171 CDS 100% 10.800 7.560 N ENTPD3 n/a
6 TRCN0000050449 CCAGGACTGAAGTATGGTATT pLKO.1 247 CDS 100% 10.800 7.560 N ENTPD3 n/a
7 TRCN0000050450 GCCAACTATTTAATGGGAAAT pLKO.1 658 CDS 100% 10.800 7.560 N ENTPD3 n/a
8 TRCN0000050451 CCTTTGACCATGCAGTGGATT pLKO.1 1652 CDS 100% 4.950 3.465 N ENTPD3 n/a
9 TRCN0000080762 TGGATGGATTACAGCCAACTA pLKO.1 645 CDS 100% 4.950 3.465 N Entpd3 n/a
10 TRCN0000080759 GCTCAAATCATTTCTGGGCAA pLKO.1 610 CDS 100% 2.160 1.512 N Entpd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001248.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10718 pDONR223 100% 85.3% 85% None 70A>G;1354_1358delGTGGG;1362_1587del n/a
2 ccsbBroad304_10718 pLX_304 0% 85.3% 85% V5 70A>G;1354_1358delGTGGG;1362_1587del n/a
3 TRCN0000470626 ACGCGGTACCCCGTTATCCACAGT pLX_317 36.7% 85.3% 85% V5 70A>G;1354_1358delGTGGG;1362_1587del n/a
Download CSV