Transcript: Human NM_001251853.1

Homo sapiens phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PIK3R5 (23533)
Length:
4389
CDS:
1135..2619

Additional Resources:

NCBI RefSeq record:
NM_001251853.1
NBCI Gene record:
PIK3R5 (23533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146461 TGCCTGTGAAGCGAAGTCAT pXPR_003 GGG 534 36% 10 0.4552 PIK3R5 PIK3R5 75760
2 BRDN0001146332 AAAGACCACAACACGTAGCG pXPR_003 TGG 391 26% 9 -0.3633 PIK3R5 PIK3R5 75759
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195068 CCTCTAACACTACAGATTATT pLKO.1 2152 CDS 100% 15.000 21.000 N PIK3R5 n/a
2 TRCN0000362372 CCTCTAACACTACAGATTATT pLKO_005 2152 CDS 100% 15.000 21.000 N Pik3r5 n/a
3 TRCN0000195514 CCCTTACTTTGCCAAAGACTT pLKO.1 2999 3UTR 100% 4.950 6.930 N PIK3R5 n/a
4 TRCN0000304058 CCCTTACTTTGCCAAAGACTT pLKO_005 2999 3UTR 100% 4.950 6.930 N PIK3R5 n/a
5 TRCN0000195530 CCTGACCATTAGCATGGTCTA pLKO.1 2894 3UTR 100% 0.405 0.567 N PIK3R5 n/a
6 TRCN0000033271 CAGGATCTATAAACTCTTCAA pLKO.1 1242 CDS 100% 4.950 3.960 N PIK3R5 n/a
7 TRCN0000300371 CAGGATCTATAAACTCTTCAA pLKO_005 1242 CDS 100% 4.950 3.960 N PIK3R5 n/a
8 TRCN0000033273 CTGACGCTAAACCTGACAGAA pLKO.1 2293 CDS 100% 4.950 3.960 N PIK3R5 n/a
9 TRCN0000199372 CGCCATCTGCTGACTTCCTTT pLKO.1 1093 5UTR 100% 4.950 3.465 N PIK3R5 n/a
10 TRCN0000033272 CTGTAGCCAATAAGCTGAGTA pLKO.1 660 5UTR 100% 4.950 3.465 N PIK3R5 n/a
11 TRCN0000300448 CTGTAGCCAATAAGCTGAGTA pLKO_005 660 5UTR 100% 4.950 3.465 N PIK3R5 n/a
12 TRCN0000033269 GCAGAACTCCAAATCCAAGAA pLKO.1 2325 CDS 100% 4.950 3.465 N PIK3R5 n/a
13 TRCN0000300450 GCAGAACTCCAAATCCAAGAA pLKO_005 2325 CDS 100% 4.950 3.465 N PIK3R5 n/a
14 TRCN0000033270 CTCACCTTCATTGATGCTGAA pLKO.1 509 5UTR 100% 4.050 2.835 N PIK3R5 n/a
15 TRCN0000195663 CTCTCTGTGGAGAACTGAATG pLKO.1 2689 3UTR 100% 10.800 6.480 N PIK3R5 n/a
16 TRCN0000304059 CTCTCTGTGGAGAACTGAATG pLKO_005 2689 3UTR 100% 10.800 6.480 N PIK3R5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11743 pDONR223 100% 100% 3.9% None n/a
2 ccsbBroad304_11743 pLX_304 0% 100% 3.9% V5 (not translated due to prior stop codon) n/a
3 TRCN0000467349 AAGCTACCCACTACACCAGGGGTA pLX_317 24.9% 100% 3.9% V5 (not translated due to prior stop codon) n/a
4 ccsbBroadEn_15014 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15014 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000472661 GTAGACTGAATAGGAGACAGGTTT pLX_317 24.4% 100% 100% V5 (not translated due to frame shift) n/a
Download CSV