Transcript: Human NM_001251877.2

Homo sapiens ubiquitin specific peptidase 4 (USP4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
USP4 (7375)
Length:
1553
CDS:
30..971

Additional Resources:

NCBI RefSeq record:
NM_001251877.2
NBCI Gene record:
USP4 (7375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004042 GAGGCGTGGAATAAACTACTA pLKO.1 324 CDS 100% 4.950 3.465 N USP4 n/a
2 TRCN0000320388 GAGGCGTGGAATAAACTACTA pLKO_005 324 CDS 100% 4.950 3.465 N USP4 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1119 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1119 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15618 pDONR223 0% 29.9% 26.1% None (many diffs) n/a
2 ccsbBroad304_15618 pLX_304 0% 29.9% 26.1% V5 (many diffs) n/a
3 ccsbBroadEn_07120 pDONR223 100% 29.8% 26.1% None (many diffs) n/a
4 ccsbBroad304_07120 pLX_304 0% 29.8% 26.1% V5 (many diffs) n/a
5 TRCN0000477449 TCACTTTTTTCGGCACCCACGTTC pLX_317 14.6% 29.8% 26.1% V5 (many diffs) n/a
Download CSV