Transcript: Human NM_001251904.1

Homo sapiens adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2 (APPL2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
APPL2 (55198)
Length:
3307
CDS:
219..2231

Additional Resources:

NCBI RefSeq record:
NM_001251904.1
NBCI Gene record:
APPL2 (55198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420727 AGAAGCACTGGCTCAATTAAT pLKO_005 2102 CDS 100% 15.000 12.000 N APPL2 n/a
2 TRCN0000413949 AGCACTTTAAAGGATCTATTT pLKO_005 597 CDS 100% 13.200 10.560 N APPL2 n/a
3 TRCN0000153927 CTCAAGTATCAAGGGCCAATT pLKO.1 1888 CDS 100% 10.800 8.640 N APPL2 n/a
4 TRCN0000154282 GCTGACAATCGTTTGTGGAAT pLKO.1 2332 3UTR 100% 4.950 3.960 N APPL2 n/a
5 TRCN0000435347 ATCTCATAATTGGACCTAATA pLKO_005 2706 3UTR 100% 13.200 9.240 N APPL2 n/a
6 TRCN0000153500 CCCACCCATCTACAATGTTAT pLKO.1 2414 3UTR 100% 13.200 9.240 N APPL2 n/a
7 TRCN0000150613 GAGAAGAATCTCTGAGTACAT pLKO.1 1996 CDS 100% 4.950 3.465 N APPL2 n/a
8 TRCN0000153746 CTGGAGAAGAATCTCTGAGTA pLKO.1 1993 CDS 100% 4.950 2.970 N APPL2 n/a
9 TRCN0000152600 GCAGACATGGTTCAAAGCATT pLKO.1 924 CDS 100% 4.950 2.970 N APPL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08489 pDONR223 100% 98.9% 98.9% None (many diffs) n/a
2 ccsbBroad304_08489 pLX_304 0% 98.9% 98.9% V5 (many diffs) n/a
3 TRCN0000481225 AGTAGTAGCAGAAGGTTCGGATTC pLX_317 18.7% 98.9% 98.9% V5 (many diffs) n/a
Download CSV