Transcript: Human NM_001252020.1

Homo sapiens transient receptor potential cation channel subfamily M member 1 (TRPM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TRPM1 (4308)
Length:
6022
CDS:
315..5243

Additional Resources:

NCBI RefSeq record:
NM_001252020.1
NBCI Gene record:
TRPM1 (4308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429621 CCTTGTGGTGAGAACCTATAT pLKO_005 3516 CDS 100% 13.200 18.480 N TRPM1 n/a
2 TRCN0000043976 GCCAGTAGTGTAAGCAGCTTA pLKO.1 5148 CDS 100% 4.950 6.930 N TRPM1 n/a
3 TRCN0000043973 CGACAAATATAGAAGGCACTA pLKO.1 4642 CDS 100% 4.050 5.670 N TRPM1 n/a
4 TRCN0000434310 ATGATACTGTAACGAAGATAA pLKO_005 5459 3UTR 100% 13.200 9.240 N TRPM1 n/a
5 TRCN0000421607 CAGCGATATCAGCTGATTATG pLKO_005 3708 CDS 100% 13.200 9.240 N TRPM1 n/a
6 TRCN0000043975 GCCAGCTTGCTTTGGAGTTAT pLKO.1 2461 CDS 100% 13.200 9.240 N TRPM1 n/a
7 TRCN0000043974 GCTTCTAGTTACCATTCAGAA pLKO.1 1358 CDS 100% 4.950 3.465 N TRPM1 n/a
8 TRCN0000043977 CGTGGATTGAAGCTCTTCCTT pLKO.1 3852 CDS 100% 3.000 2.100 N TRPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10972 pDONR223 100% 7% 5.1% None (many diffs) n/a
2 ccsbBroad304_10972 pLX_304 0% 7% 5.1% V5 (many diffs) n/a
3 TRCN0000467231 CAGTCAATCTATGAAAGGGAGACG pLX_317 84.8% 7% 5.1% V5 (many diffs) n/a
Download CSV