Transcript: Human NM_001252151.2

Homo sapiens solute carrier family 39 member 9 (SLC39A9), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
SLC39A9 (55334)
Length:
4845
CDS:
479..1048

Additional Resources:

NCBI RefSeq record:
NM_001252151.2
NBCI Gene record:
SLC39A9 (55334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377510 TGCGTTGATGGAAGGTCATAG pLKO_005 1521 3UTR 100% 10.800 15.120 N SLC39A9 n/a
2 TRCN0000376564 ACACAGCTGCATGCCTATATT pLKO_005 428 5UTR 100% 15.000 10.500 N SLC39A9 n/a
3 TRCN0000370173 CAGACCAGTGTCCAGTTAATT pLKO_005 635 CDS 100% 15.000 10.500 N SLC39A9 n/a
4 TRCN0000435349 TCAGTAGGACACCAGCATTAA pLKO_005 1028 CDS 100% 13.200 9.240 N SLC39A9 n/a
5 TRCN0000365122 TGCTACTTTATCCATTGATTT pLKO_005 1450 3UTR 100% 13.200 9.240 N SLC39A9 n/a
6 TRCN0000038633 TGTGGCAATCATGCTACATAA pLKO.1 661 CDS 100% 13.200 9.240 N SLC39A9 n/a
7 TRCN0000038629 GCCGGGACATTTCTTTATGTT pLKO.1 875 CDS 100% 5.625 3.938 N SLC39A9 n/a
8 TRCN0000038631 GCAAGGTCTAGCAATTCCAAA pLKO.1 539 CDS 100% 4.950 3.465 N SLC39A9 n/a
9 TRCN0000038632 GCATCAGACAAAGCAGCAGAA pLKO.1 368 5UTR 100% 4.050 2.835 N SLC39A9 n/a
10 TRCN0000370174 GCATTGGCAGCACCAGTTATG pLKO_005 767 CDS 100% 10.800 6.480 N SLC39A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08523 pDONR223 100% 61.4% 61.2% None 0_1ins354;499C>T n/a
2 ccsbBroad304_08523 pLX_304 0% 61.4% 61.2% V5 0_1ins354;499C>T n/a
3 TRCN0000470805 GTGCTAACCTGGTGTTCCTGAGCC pLX_317 52.7% 61.4% 61.2% V5 0_1ins354;499C>T n/a
Download CSV