Transcript: Mouse NM_001252188.1

Mus musculus epsin 2 (Epn2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Epn2 (13855)
Length:
4474
CDS:
362..2284

Additional Resources:

NCBI RefSeq record:
NM_001252188.1
NBCI Gene record:
Epn2 (13855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294716 CAGTGGCTCCTTCGAACATTA pLKO_005 1485 CDS 100% 13.200 9.240 N Epn2 n/a
2 TRCN0000294656 CCTACCAGTGTGGAGCTTTAA pLKO_005 2735 3UTR 100% 13.200 9.240 N Epn2 n/a
3 TRCN0000111742 CCACGAGTATCCTCTGAGTTA pLKO.1 1136 CDS 100% 4.950 3.465 N Epn2 n/a
4 TRCN0000111743 GCATGGTTTGGAAGCGACTTA pLKO.1 534 CDS 100% 4.950 3.465 N Epn2 n/a
5 TRCN0000287206 GCATGGTTTGGAAGCGACTTA pLKO_005 534 CDS 100% 4.950 3.465 N Epn2 n/a
6 TRCN0000111744 CCTCTTTGAGTCTCAATCCTT pLKO.1 1831 CDS 100% 3.000 2.100 N Epn2 n/a
7 TRCN0000287207 CCTCTTTGAGTCTCAATCCTT pLKO_005 1831 CDS 100% 3.000 2.100 N Epn2 n/a
8 TRCN0000111741 CGGTACAGTTAAAGATGATTT pLKO.1 1720 CDS 100% 13.200 7.920 N Epn2 n/a
9 TRCN0000287148 CGGTACAGTTAAAGATGATTT pLKO_005 1720 CDS 100% 13.200 7.920 N Epn2 n/a
10 TRCN0000111740 CCAGGAAGTAACCACATCCTA pLKO.1 3553 3UTR 100% 3.000 1.800 N Epn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14071 pDONR223 100% 77.1% .3% None (many diffs) n/a
2 ccsbBroad304_14071 pLX_304 0% 77.1% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481307 TAACGCCCAATATAATTTTGCCCT pLX_317 22.7% 77.1% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV