Transcript: Mouse NM_001252437.1

Mus musculus mahogunin, ring finger 1 (Mgrn1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mgrn1 (17237)
Length:
3293
CDS:
287..1888

Additional Resources:

NCBI RefSeq record:
NM_001252437.1
NBCI Gene record:
Mgrn1 (17237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039465 GCCTTCTTTCAAGATTGACTT pLKO.1 808 CDS 100% 4.950 6.930 N Mgrn1 n/a
2 TRCN0000039466 GAAACTACTTTGCTTCGCATT pLKO.1 378 CDS 100% 4.050 3.240 N Mgrn1 n/a
3 TRCN0000039467 CGGCATCGAGAACAAGAACAA pLKO.1 1051 CDS 100% 4.950 3.465 N Mgrn1 n/a
4 TRCN0000039464 GCACTCTAGTTCTGACAGTAT pLKO.1 1348 CDS 100% 4.950 3.465 N Mgrn1 n/a
5 TRCN0000039468 CGTGCTCTACAGTCTGGAATT pLKO.1 634 CDS 100% 0.000 0.000 N Mgrn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02747 pDONR223 100% 78.3% 81.2% None (many diffs) n/a
2 ccsbBroad304_02747 pLX_304 0% 78.3% 81.2% V5 (many diffs) n/a
3 TRCN0000466993 CTGAGGTAACTTTCACCTCCACCT pLX_317 20.8% 78.3% 81.2% V5 (many diffs) n/a
Download CSV