Transcript: Mouse NM_001252481.1

Mus musculus SMAD family member 2 (Smad2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Smad2 (17126)
Length:
8863
CDS:
443..1846

Additional Resources:

NCBI RefSeq record:
NM_001252481.1
NBCI Gene record:
Smad2 (17126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089336 TGGTGTTCAATCGCATACTAT pLKO.1 1262 CDS 100% 5.625 7.875 N Smad2 n/a
2 TRCN0000327446 TGGTGTTCAATCGCATACTAT pLKO_005 1262 CDS 100% 5.625 7.875 N Smad2 n/a
3 TRCN0000040037 CCTAAGTGATAGTGCAATCTT pLKO.1 1489 CDS 100% 5.625 4.500 N SMAD2 n/a
4 TRCN0000288652 CCTAAGTGATAGTGCAATCTT pLKO_005 1489 CDS 100% 5.625 4.500 N SMAD2 n/a
5 TRCN0000010477 CAAGTACTCCTTGCTGGATTG pLKO.1 1737 CDS 100% 6.000 4.200 N SMAD2 n/a
6 TRCN0000295815 CAAGTACTCCTTGCTGGATTG pLKO_005 1737 CDS 100% 6.000 4.200 N SMAD2 n/a
7 TRCN0000089337 CTAAGTGATAGTGCAATCTTT pLKO.1 1490 CDS 100% 5.625 3.938 N Smad2 n/a
8 TRCN0000327372 CTAAGTGATAGTGCAATCTTT pLKO_005 1490 CDS 100% 5.625 3.938 N Smad2 n/a
9 TRCN0000089335 CCACTGTAGAAATGACAAGAA pLKO.1 1410 CDS 100% 4.950 3.465 N Smad2 n/a
10 TRCN0000327370 CCACTGTAGAAATGACAAGAA pLKO_005 1410 CDS 100% 4.950 3.465 N Smad2 n/a
11 TRCN0000089333 CCCATCAAAGACTCGCTGTAA pLKO.1 1848 3UTR 100% 4.950 3.465 N Smad2 n/a
12 TRCN0000327371 CCCATCAAAGACTCGCTGTAA pLKO_005 1848 3UTR 100% 4.950 3.465 N Smad2 n/a
13 TRCN0000089334 CGGTTAGATGAGCTTGAGAAA pLKO.1 611 CDS 100% 4.950 3.465 N Smad2 n/a
14 TRCN0000327447 CGGTTAGATGAGCTTGAGAAA pLKO_005 611 CDS 100% 4.950 3.465 N Smad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00961 pDONR223 100% 92.2% 99.5% None (many diffs) n/a
2 ccsbBroad304_00961 pLX_304 0% 92.2% 99.5% V5 (many diffs) n/a
3 TRCN0000465710 TTTCGGTCGAACATAGACGACCGG pLX_317 25.6% 92.2% 99.5% V5 (many diffs) n/a
Download CSV